Вирус коксаки форум: Attention Required! | Cloudflare

Детский инфекционист о вирусе Коксаки, ветрянке, прививках и лечении без лекарств

Александр Кудин, заведующий отделением городской детской инфекционной клинической больницы, кандидат медицинских наук, доцент, рассказал о том, почему не стоит бояться вируса Коксаки, зачем прививаться от ветрянки и гриппа и как вылечиться от простуды без лекарств.

«Человек в большинстве случаев с вирусными инфекциями справляется сам»

— С какими инфекционными заболеваниями у детей вы чаще всего сталкиваетесь в своей работе?

— Самые распространенные инфекции и у детей, и у взрослых — респираторные. Это то, что в народе называется простудой. Наше отделение также занимается лечением кишечных инфекций, они вторые по частоте.

К нам поступают дети с разными заболеваниями, которые могут сопровождаться рвотой: с пиелонефритами (воспалительное заболевание почек бактериальной этиологии. — Прим. TUT.BY), сейчас из-за сезонности много пациентов с пневмонией, отитами.

— Если это простая простуда, то в инфекционку же вряд ли отправят?

— В этом случае не надо отправлять, но иногда отправляют. Бывает, что у ребенка высокая температура и мама сильно беспокоится, или врачи решили перестраховаться, поэтому и направляют к нам.

— С лета актуален вопрос по поводу вируса Коксаки. И Минздрав давал рекомендации по этому поводу отдыхающим в Турции, и к нам в редакцию приходили письма читателей, где родители предполагали, что у их детей Коксаки. В то же время на пресс-конференциях медики объясняли журналистам, что фактов вируса Коксаки в Беларуси нет, и чтобы его определить, нужна лабораторная диагностика.

— Совершенно верно.

Александр Кудин, заведующий отделением городской детской инфекционной клинической больницы, кандидат медицинских наук, доцент

— Но так ли опасен Коксаки?

— Эта популярная тема про Коксаки возникла после того, как в Турции была якобы вспышка этой инфекции. Я не знаю, кто в Турции сказал, что это Коксаки. Ту форму болезни, которая тогда была, чаще всего вызывает энтеровирус 71-го типа. Хотя нечто подобное могут вызвать и другие энтеровирусы. Самих энтеровирусов очень много, только их серотипов больше 60. Есть ЕСНО-вирусы, вирусы Коксаки типов А и Б, даже гепатит А вызывает определенный энтеровирус…

Для пациентов и врачей в общем-то неважно, какой энтеровирус вызвал то или иное заболевание. Энтеровирусная инфекция, как большинство вирусных инфекций, не требует никакого специального лечения. Нужны просто терпение, время и небольшая помощь, чтобы легче перенести инфекцию. Человек в большинстве случаев с вирусными инфекциями справляется сам, ему надо только не мешать и немножко помочь.

Поэтому был там Коксаки, или ЕСНО-вирус, или энтеровирус 71-го типа — не имеет значения. Чаще всего все заканчивается благоприятно: за пять-семь дней дети выздоровели и забыли об этом. Но любые энтеровирусы способны поражать различные органы, хоть это и бывает редко. Самое неприятное, когда вирус поражает центральную нервную систему и сердце, вызывая развитие менингитов, энцефалитов и кардитов. Эти ситуации требуют специального лечения.

Поэтому в принципе энтеровирусная инфекция не требует лечения, а требует наблюдения. Активно подключаться нужно только при поражении указанных органов.

— При энтеровирусной инфекции обязательно будут понос и высокая температура?

— Энтеровирусы влияют на слизистые дыхательных путей и желудочного тракта, мышечной ткани, сердечной мышцы. Симптомов энтеровирусной инфекции около десятка, поэтому нет четко очерченной специфической картины, как при кори или ветрянке, где мы точно знаем, как должна развиваться болезнь. При энтеровирусной инфекции может быть все что угодно, в том числе и лихорадка с диареей.

— И сыпь, и температура?

— Температура в таких случаях часто высокая, боль в горле может быть сильнее, чем при ангине.

— Как ребенок может заразиться этой инфекцией?

— Вирус хорошо сохраняется в воде. Ребенок поплавал в бассейне или море, хлебнул воды — и, если не повезло, заразился энтеровирусом. Это самый частый путь передачи. Также, но реже, вирус передается воздушно-капельным путем, контактным, пищевым. Например, человек взял в руки плохо вымытый фрукт, руки плохо помыл и донес вирус до рта или съел немытый плод — и заболел.

— Эти инфекции больше характерны для курортных стран как Турция?

— Нет. С конца августа до октября у нас в отделении с этими энтеровирусами лежала почти половина больных. Может, я чуть преувеличиваю, но их было очень много.

— Вы говорите, что ребенка не надо трогать и что ничего страшного с ним не происходит во время энтеровирусной инфекции. Но как тогда его лечить?

— Ему нужно обеспечить хороший отдых, правильное питание, достаточное питье и сбивать температуру, если она очень высокая.

— И она сама пройдет?

— Не поверите, но пройдет.

— И Коксаки?

— Разницы нет. Инфекция Коксаки лечится так же.

— Если у врача есть подозрения на энтеровирусную инфекцию, ее нужно подтверждать лабораторно?

— А зачем? Какой смысл, если все подходы к лечению одинаковые?

— Что в этом случае можно сказать родителям, которые все-таки паникуют. Мы наблюдали за этой паникой и в соцсетях, когда люди выкладывали фотографии детей, считая, что это что-то крайне опасное.

— Если родители адекватные, то они должны прислушаться к тому, что говорят врачи, а если они не верят врачам, то кто бы ни говорил, они все равно не поверят и будут паниковать, пока ребенок не поправится.

Приведу другой пример: бывает так, что мамы обижаются, когда сюда поступают, и я им ничего не назначаю из лечения. Но значит так нужно вашему ребенку: то есть никак. Когда я заканчивал институт, думал, что чем больше таблеток, тем лучше. Но сейчас я понимаю: чтобы не назначить лекарство, нужно знать значительно больше, чем чтобы его назначить.

«Видел человек десять, которые повторно болели ветрянкой»

— От ветрянки сегодня прививают?

— Прививать начали несколько лет назад, но эта вакцина достаточно дорогая по сравнению с другими вакцинами.

— Почему раньше не прививали?

— У нас не было вакцины.

— Как вам кажется, ребенка от ветрянки лучше привить или пусть переболеет?

— Теоретически лучше привить. Даже если ребенок заболеет после прививки, то болезнь он перенесет легче. Ветрянка у некоторых детей чревата вероятностью развития осложнений. Чаще всего это или гнойные осложнения со стороны кожи и мягких тканей, или поражение нервной системы. Но все это редко бывает. Однако, если это случится конкретно у вашего ребенка, то вам будет безразлична статистика.

— В каком возрасте нужно прививать ребенка от ветрянки и нужно ли повторять вакцинопрофилактику?

— Детям такую прививку можно делать после 6 месяцев. Повторять ее не нужно. Но там сама прививка состоит из двух этапов, при этом прививают живой вакциной. Такие вакцины дают хороший иммунитет с иммунологической памятью, поэтому одного раза хватает на всю жизнь. Человек так или иначе будет контактировать с этим вирусом. Если вирус попадет в подготовленный организм, естественный иммунный ответ разовьется быстрее, и защита будет сильнее.

На мой взгляд, наиболее важно, чтобы привились от ветрянки взрослые, которые ею не болели и не контактировали с больными. Ведь при контакте тоже мог сформироваться иммунитет, и человек даже не знал, что перенес ветрянку в такой скрытой форме.

В целом ветряная оспа у взрослых протекает тяжелее, чем у детей: больше сыпи и сильнее интоксикация. И если вы в детстве не болели и не контактировали с больными ветрянкой, пришли в гости, а вам открыл дверь ребенок в зеленке, то все — время пошло. С этого момента у вас есть три дня, чтобы привиться и тем самым предупредить развитие ветряной оспы.

— Ребенок, который переболел, может заболеть во второй раз?

— Теоретически не должен, но практически — да. Иммунитет после перенесенной инфекции в редких случаях не срабатывает. Я в своей жизни видел человек десять, которые повторно болели ветряной оспой. Пятеро из них — мои студенты. Когда я преподавал в университете, говорил, что все должны увидеть ветрянку, потрогать и заработать иммунитет. Заработали. Ничего — все живы и здоровы.

«Нет таких прививок, которые после вакцинации дают стопроцентную защиту»

— Как узнать, в каком состоянии у тебя иммунная система, не сдавая лабораторный анализ?

— Если человек дожил до пяти-шести лет, а тем более до 20, то никаких больших проблем с иммунной системой у него, скорее всего, нет. Не надо нигде ничего искать. Если человек часто болеет простудами, значит у него есть какие-то особенности работы врожденного иммунитета против вируса. Это может быть на уровне выработки интерферона или на уровне рецепции интерферона, или его разрушения. Там много механизмов, почему может плохо работать эта система.

Если вы уже взрослый человек, то значит, никакого грубого иммунного дефицита у вас нет. Конечно, за исключением ситуаций, когда человек болен СПИДом. Вот если он заработал эту инфекцию, то постепенно иммунодефицит без лечения будет прогрессировать и человек будет часто болеть. Но если вы шесть-восемь раз в год болеете простудой, и так всю жизнь — это особенности организма. Поверьте мне, даже если вдруг вы найдете причину, все равно эту наследственную вещь не исправить.

— Как укрепить иммунитет ребенка?

— Надо правильно и хорошо питаться, отдыхать, заниматься закаливанием и проводить вакцинацию. Ведь поднять иммунитет можно с помощью прививки. Вам предложили вакцинироваться против той же ветрянки — не отказывайтесь, против гриппа — вакцинируйтесь. Во-первых, вы зарабатываете иммунитет против конкретной инфекции, во-вторых, особенностью работы нашей иммунной системы является то, что прежде, чем выработать защиту против конкретного возбудителя, активируются факторы врожденного иммунитета. То есть активируется то, что защищает человека вообще от всего.

Правильное питание важно, потому что 70% всей лимфоидной ткани человека — это иммунная ткань, она сгруппирована в кишечнике. Правильное питание обеспечивает нормальный рост микробов кишечника, а те в свою очередь будут стимулировать местный и общий иммунитет.

Сон тоже важен. Взрослому надо спать не меньше семи часов, у детей потребности больше, им нужно минимум восемь часов. Поэтому, если ребенок заболел, важно дать ему хорошо отдохнуть. Подремал полчаса, проснулся, хочет поиграть — пусть поиграет, когда вы увидите, что он снова стал какой-то вялый, нужно прилечь. Он может не спать, а просто подремать в спокойном состоянии — и ему станет после этого лучше.

Я сам когда-то проверил этот способ лечения простуды. Три дня вел себя именно так: спал, как хотел, ел, как хотел — и через три дня был здоров. Я был поражен. Другое дело, что взрослый человек себе не может этого позволить. После этого я так больше никогда не расслаблялся. Но я знаю, что это во многих случаях должно помочь, если мы говорим о вирусной инфекции. Но если речь идет о бактериальной, то там чаще всего требуется антибактериальное лечение.

— Но вы знаете, что есть родители, которые в принципе против прививок.

— В Европе отказываются от прививок. В итоге несколько лет назад во Франции было 30 тысяч случаев кори. Там, где отказываются, сразу получают эти инфекции. Ведь их возбудители никуда не делись, они циркулируют.

— В своей практике вы встречали родителей, которые наотрез отказывались прививать ребенка?

— Встречал, но они чем-то из этих инфекций по итогу и болели.

— По кори были вспышки в Украине. Если привитый ребенок поедет туда с родителями, какой шанс, что он может заразиться?

— К сожалению, нет таких прививок, которые после вакцинации дают 100% защиту. Отличный результат, если 95% из привитых детей заработают иммунитет. Но если ребенка привили по всем правилам качественной вакциной и его состояние во время прививки было нормальное, то вакцинация должна защитить.

— Смысл прививать детей от гриппа в этом году еще есть?

— Пока нет подъема заболеваемости, смысл есть. На мой взгляд, в декабре еще можно спокойно прививаться. Уже какой-то иммунный ответ сформируется даже через семь дней после прививки. Прививать детей против гриппа можно с шести месяцев.

— Может быть так, что родители, которые кутают своих детей в детстве и оберегают от малейшего ветерка, тем самым ухудшают им иммунитет?

— Ухудшить или улучшить иммунтет — это не совсем корректное выражение. Кто-то может получить от родителей генетически высокий уровень иммунитета, но при этом пить, курить и не реализовать его на 100%, поэтому и часто болеть. А у кого-то изначально могут быть исходные данные хуже, но человек реализует все возможности по полной.

«В сезон гриппа к нам в приемное отделение привозят до 150 пациентов в день»

— В чем специфика детской городской инфекционной больницы?

— У нас больница рассчитана на 600 с небольшим коек. И к большому счастью, мы заполнены не всегда, потому что должен быть какой-то резерв коечного фонда. То есть заполняемость должна быть на уровне 70%. Если больше — это значит, что не будет резерва для разобщения детей с разными по этиологии и срокам заболевания инфекциями.

У нас самая большая больница из детских, и она, образно говоря, «самая острая». То есть у нас дети лежат здесь не так долго, как в других детских стационарах, где лечат хронические болезни. В этом плане у нас ситуация отличается — пациенты находятся здесь неделю плюс-минус несколько дней.

— Часто у людей предубеждения по поводу инфекционных больниц: не хотят туда ехать, потому что опасаются подхватить еще какую-нибудь инфекцию. Насколько это оправданно?

— Если бы у нас была возможность, чтобы все пациенты находились в отдельных палатах, такой риск был бы минимальным. Но сейчас к нам в день в приемное отделение поступает 80 человек, в сезон гриппа — может доходить до 150 больных, сами понимаете, содержать всех в отдельных палатах просто невозможно. В новом корпусе у нас палаты на двоих человек. Но представьте ситуацию: поступают оба пациента с рвотой и температурой, мы их кладем в одну палату, но у одного из них на следующий день развился понос, а у другого — нашли пневмонию. И если понос возник из-за ротавирусной инфекции, то и второй пациент может ею заболеть. Что можно сделать в этой ситуации? Ничего.

С другой стороны, визит в поликлинику всегда несет в себе риск дополнительного инфицирования из-за большого количества больных с различными инфекциями. Или, к примеру, посещение каких-либо массовых мероприятий, или даже крупного магазина может привести к инфицированию. Но мы же от этого не отказываемся. Вопрос должен стоять иначе: нужна ли госпитализация? И если нужна, то, безусловно, следует ехать в больницу, не рассуждая о гипотетической вероятности дополнительной инфекции. А вот «на всякий случай» ехать в больницу не стоит.

Если есть возможность лечиться дома, то надо лечиться дома. Обязательно нужно ехать в больницу, когда у ребенка выраженная вялость, нарушение сознания, повторная многократная рвота, не сбивается температура, судороги, отказ от еды и питья, сниженное мочеотделение. Врач обязательно должен осмотреть малыша, если у него появилась сыпь с высокой температурой, так как в ряде случаев это может быть проявлением очень серьезного заболевания. Но если у ребенка в возрасте старше года температура 38 градусов, которая сбивается, стул три раза и один раз в день рвота, что ему делать в больнице?

— Как часто родители стремятся без показаний покинуть больницу раньше времени?

— Так бывает часто. Они сюда приезжают, им снимают интоксикацию, ребенку становится лучше, и многие хотят уехать домой, не до конца вылечившись. Мы стараемся этому не препятствовать за редким исключением, когда сами не уверены в том, как болезнь будет дальше развиваться. Это маме кажется, что все хорошо, а на самом деле мы по каким-то признакам понимаем, что здесь не все определено.

симптомы и лечение (памятка для родителей)

01.09.2018



Энтеровирусные инфекции– это группа заболеваний, в основе причин которых лежит несколько разновидностей вирусов. Вызывают заболевание вирусы Коксаки, полиовирусы и ЕСНО (экхо).


После перенесенной энтеровирусной инфекции образуется стойкий пожизненный иммунитет, однако, он сероспецифичен. Это значит, что иммунитет образуется только к тому серологическому типу вируса, которым переболел ребенок и не защищает его от других разновидностей этих вирусов. Поэтому энтеровирусной инфекцией ребенок может болеть несколько раз за свою жизнь. Так же эта особенность не позволяет разработать вакцину, чтобы защитить наших детей от данного заболевания. Заболевание имеет сезонность: вспышки заболевания чаще всего наблюдаются в летне-осенний период.


Причины заражения энтеровирусной инфекцией.



Заражение происходит несколькими путями. Вирусы в окружающую среду могут попадать от больного ребенка или от ребенка, который является вирусоносителем. У вирусоносителей нет никаких проявлений заболеваний, однако вирусы находятся в кишечнике и выделяются в окружающую среду с калом. Такое состояние может наблюдаться у переболевших детей после клинического выздоровления либо у детей, у которых вирус попал в организм, но не смог вызвать заболевание из-за сильного иммунитета ребенка. Вирусоносительство может сохраняться на протяжении 5 месяцев.



Попав в окружающую среду, вирусы могут сохраняться довольно долго, так как хорошо переносят неблагоприятное воздействие. Хорошо сохраняются вирусы в воде и почве, при замораживании могут выживать на протяжении нескольких лет, устойчивы к действию дезинфицирующих средств (при воздействии растворов высокой концентрации фенола, хлора, формалина вирусы начинают погибать только через три часа), однако восприимчивы к действию высоких температур (при нагревании до 45ºС погибают через 45-60 секунд).


Как передается энтеровирусная инфекция.



Механизм передачи может быть воздушно-капельный (при чихании и кашле с капельками слюны от больного ребенка к здоровому) и фекально-оральный при не соблюдении правил личной гигиены. Чаще всего заражение происходит через воду, при употреблении сырой (не кипяченой) воды. Так же возможно заражение детей через игрушки, если дети их берут в рот. Болеют чаще всего дети в возрасте от 3 до 10 лет. У детей, находящихся на грудном вскармливании, в организме присутствует иммунитет, полученный от матери через грудное молоко, однако, этот иммунитет не стойкий и после прекращения грудного вскармливания быстро исчезает.


Симптомы энтеровирусной инфекции.



В организм вирусы попадают через рот или верхние дыхательные пути. Попав в организм ребенка, вирусы мигрируют в лимфатические узлы, где они оседают и начинают размножаться. Дальнейшее развитие заболевания связано со многими факторами, такими как вирулентность (способность вируса противостоять защитным свойствам организма), тропизмом (склонностью поражать отдельные ткани и органы) вируса и состоянием иммунитета ребенка.



У энтеровирусных инфекций есть как схожие проявления, так и различные, в зависимости от вида и серотипа. Инкубационный период (период от попадания вируса в организм ребенка, до появления первых клинических признаков) у всех энтеровирусных инфекций одинаковый – от 1 до 10 дней (чаще 2-5 дней).



Заболевание начинается остро — с повышения температуры тела до 38-39º С. Температура чаще всего держится 3-5 дней, после чего снижается до нормальных цифр. Очень часто температура имеет волнообразное течение: 2-3 дня держится температура, после чего снижается и 2-3 дня находится на нормальных цифрах, затем снова поднимается на 1-2 дня и вновь нормализуется уже окончательно. При повышении температуры ребенок ощущает слабость, сонливость, может наблюдаться головная боль, тошнота, рвота. При снижении температуры тела все эти симптомы проходят, однако при повторном повышении могут вернуться. Также увеличиваются шейные и подчелюстные лимфоузлы, так как в них происходит размножение вирусов.



В зависимости от того, какие органы больше всего поражаются, выделяют несколько форм энтеровирусной инфекции. Энтеровирусы могут поражать: центральную и периферическую нервные системы, слизистую ротоглотки, слизистую глаз, кожу, мышцы, сердце, слизистую кишечника, печень, у мальчиков возможно поражение яичек.



При поражении слизистой ротоглотки происходит развитиеэнтеровирусной ангины.Она проявляется повышением температуры тела, общей интоксикацией (слабость, головная боль, сонливость) и наличием везикулярной сыпи в виде пузырьков, заполненных жидкостью, на слизистой ротоглотки и миндалинах. Пузырьки эти лопаются, на их месте образуются язвочки, заполненные белым налетом. После выздоровления на месте язвочек не остается никаких следов.



При поражении глаз развиваетсяконъюнктивит.Он может быть одно- и двусторонним. Проявляется в виде светобоязни, слезотечения, покраснения и припухлости глаз. Возможно наличие кровоизлияний в конъюнктиву глаза.



При поражении мышц развиваетсямиозит– боли в мышцах. Боли появляются на фоне повышения температуры. Болезненность наблюдается в грудной клетке, руках и ногах. Появление болей в мышцах, как и температуры, может носить волнообразный характер. При снижении температуры тела боли уменьшаются или исчезают совсем.



При поражении слизистой кишечника(энтерит)наблюдается наличиежидкого стула. Стул обычной окраски (желтый или коричневый), жидкий, без патологических (слизь, кровь) примесей. Появление жидкого стула может быть как на фоне повышение температуры, так, и изолировано (без повышения температуры тела).



Энтеровирусные инфекции могут поражать различные участки сердца. Так при поражении мышечного слоя развиваетсямиокардит, при поражении внутреннего слоя с захватом клапанов сердца, развиваетсяэндокардит, при поражении внешней оболочки сердца –перикардит. У ребенка может наблюдаться: повышенная утомляемость, слабость, учащенное сердцебиение, падение артериального давления, нарушения ритма (блокады, экстрасистолы), боли за грудиной.



При поражении нервной системы могут развиватьсяэнцефалиты, менингиты. У ребенка наблюдается: сильная головная боль, тошнота, рвота, повышение температуры тела, судороги, парезы и параличи, потеря сознания.



При поражении печени развиваетсяострый гепатит. Он характеризуется увеличением печени, чувством тяжести в правом подреберье, болью в этом месте. Возможно появление тошноты, изжоги, слабости, повышения температуры тела.



При поражении кожи возможно появлениеэкзантемы– гиперемия (красное окрашивание) кожи, чаще всего на верхней половине туловища (голова, грудь, руки), не приподнимается над уровнем кожи, появляется одномоментно.



У мальчиков возможно наличие воспаления в яичках с развитиеморхита. Чаще всего такое состояние развивается через 2-3 недели после начала заболевания с другими проявлениями (ангина, жидкий стул и другие). Заболевание довольно быстро проходит и не несет никаких последствий, однако, в редких случаях возможно развитие в половозрелом возрасте аспермии (отсутствие спермы).



Также существуютврожденные формы энтеровирусной инфекции, когда вирусы попадают в организм ребенка через плаценту от матери. Обычно такое состояние имеет доброкачественное течение и излечивается самостоятельно, однако в некоторых случаях энтеровирусная инфекция может вызвать прерывание беременности (выкидыш) и развитие у ребенка синдрома внезапной смерти (смерть ребенка наступает на фоне полного здоровья).



Очень редко возможно поражение почек, поджелудочной железы, легких. Поражение различных органов и систем может наблюдаться как изолированное, так и сочетанное.



Лечение энтеровирусной инфекции



Специфического лечения энтеровирусной инфекции не существует. Лечение проводят в домашних условиях, госпитализация показана при наличии поражения нервной системы, сердца, высокой температуры, которая долго не поддается снижению при использовании жаропонижающих средств. Ребенку показан постельный режим на весь период повышения температуры тела.



Питание должно быть легким, богатым белками. Необходимо достаточное количество жидкости: кипяченая вода, минеральная вода без газов, компоты, соки, морсы.



Лечение проводят симптоматически в зависимости от проявлений инфекции — ангина, конъюнктивит, миозит, жидкий стул, поражения сердца, энцефалиты, менингиты, гепатит, экзантема, орхит. В некоторых случаях (ангина, понос, конъюнктивит…) проводят профилактику бактериальных осложнений.



Дети изолируются на весь период заболевания. В детском коллективе могут находиться после исчезновения всех симптомов заболевания.


Профилактика энтеровирусной инфекции.



Для профилактики необходимо соблюдение правил личной гигиены: мыть руки после посещения туалета, прогулки на улице, пить только кипяченую воду или воду из заводской бутылки, недопустимо использование для питья ребенка воды из открытого источника (река, озеро).



Специфической вакцины против энтеровирусной инфекции не существует, так как в окружающей среде присутствует большое количество серотипов этих вирусов.

ЭНТЕРОВИРУСНАЯ ИНФЕКЦИЯ: ЧТО НАДО ЗНАТЬ

ЭНТЕРОВИРУСНАЯ ИНФЕКЦИЯ: ЧТО НАДО ЗНАТЬ

Энтеровирусная инфекция. Название одно, а заболеваний, которые можно отнести к этому типу, — великое множество. О том, что это такое, как передаётся и что делать, если педиатр ставит ребёнку соответствующий диагноз, рассказывает заместитель главного врача Республиканской инфекционный больницы Наталья Зборовская.

Энтеровирусные инфекции у детей – обширная группа заболеваний, вызываемых РНК-содержащими неполиомиелитными вирусами (Коксаки, ECHO, неклассифицированными энтеровирусами человека) и полиовирусом. В силу специфичности вызываемых поражений, полиомиелит стоит несколько обособленно в ряду энтеровирусных инфекций у детей, поэтому рассматривается нами отдельно. В рамках данного обзора остановимся на энтеровирусных инфекциях неполиомиелитной этиологии, распространенных среди детей.

Наряду с ОРВИ, энтеровирусные инфекции встречаются в педиатрии довольно часто. Ежегодно среди общего количества больных энтеровирусной инфекцией удельный вес детей составляет 80-90%; из них половина случаев заболевания приходится на детей младшего возраста. Учитывая полиморфизм клинических проявлений, энтеровирусные инфекции у детей представляют интерес не только для специалистов в области инфекционных болезней, но и неврологии, гастроэнтерологии, кардиологии, офтальмологии, отоларингологии.

Причины энтеровирусной инфекции у детей

Возбудителями энтеровирусных инфекций неполиомиелитной этиологии у детей выступают вирусы Коксаки А (24 серотипа), Коксаки В (6 серотипов), ECHO (34 серотипа) и неклассифицированные энтеровирусы человека 68-71 серотпипов. Всех неполиомиелитных энтеровирусов объединяет устойчивость к низким температурам (замораживанию, оттаиванию) и быстрая инактивация в условиях высокой температуры (при кипячении) или воздействии хлорсодержащих растворов, йода, формалина, перекиси водорода, УФО.

Источниками энтеровирусной инфекции могут служить дети и взрослые, являющиеся вирусоносителями или больными манифестной формой заболевания. Передача инфекции от человека к человеку осуществляется воздушно-капельным или фекально-оральным путями; реже отмечается трансплацентарная передача. Сезонные подъемы заболеваемости энтеровирусными инфекциями среди детей отмечаются в конце лета – начале осени. Наибольшая заболеваемость регистрируется среди детей в возрасте от 3 до 10 лет. Взрослые и дети старшего возраста заболевают реже, что объясняется наличием у них иммунитета, сформировавшегося вследствие бессимптомной инфекции. Наряду со спорадическими случаями и эпидемическими вспышками энтеровирусной инфекции в детских коллективах, встречаются крупные эпидемии, поражающие целые регионы.

Проникновение энтеровирусов в организм происходит через слизистые оболочки пищеварительного и респираторного тракта. Репликация вирусов происходит в лимфоидной ткани, эпителии ротоглотки и ЖКТ, поэтому ранними клиническими проявлениями энтеровирусной инфекции у ребенка могут быть герпетическая ангина, фарингит, диарея и пр. Дальнейшее распространение вирусов по организму происходит гематогенным путем. Обладая органотропностью, энтеровирусы могут поражать нервную ткань, мышцы, покровные ткани, сосуды глаз и т. д. После перенесенной энтеровирусной инфекции у детей формируется типоспецифический иммунитет к тому серологическому типу вируса, которым было вызвано заболевание.

Классификация энтеровирусной инфекции у детей

В зависимости ведущего клинического синдрома, различают типичные и атипичные энтеровирусные инфекции у детей. Типичные формы могут проявляться в виде изолированных или комбинированных поражений: герпетической ангины, катара верхних дыхательных путей, гастроэнтерита, эпидемической миалгии, энтеровирусной лихорадки, энтеровирусной экзантемы, гепатита. Поражение нервной системы при энтеровирусной инфекции у детей может протекать по типу энцефалита, серозного менингита, энцефаломиокардита новорожденных, параличей; поражение сердца – в виде миокардита и перикардита; поражение глаз – в виде геморрагического конъюнктивита и увеита; поражение мочеполовой системы – в форме геморрагического цистита, орхита, эпидидимита. К атипичным формам энтеровирусной инфекции у детей относятся случаи стертого и бессимптомного течения.

С учетом выраженности клинических признаков энтеровирусная инфекция у детей может иметь легкое, среднетяжелое и тяжелое течение. Критериями степени тяжести выступают выраженность местных изменений и интоксикационного синдрома. По характеру течения энтеровирусные инфекции у детей подразделяются на неосложненные и осложненные.

Симптомы энтеровирусной инфекции у детей

Несмотря на полиморфизм клинических проявлений, течению различных энтеровирусных инфекций у детей свойственны некоторые общие черты. Длительность инкубационного периода составляет от 2 до 10 дней (в среднем 2-4 дня). Манифестация заболевания происходит остро, с высокой лихорадки (39-40 °С), озноба, головной боли, слабости, нарушения сна, отсутствия аппетита, повторной рвоты.

При любой форме энтеровирусной инфекции у детей отмечается гиперемия кожи лица, шеи и верхней половины туловища, инъекция сосудов конъюнктивы и склеры. Возможно появление полиморфной пятнисто-папулезной сыпи, гиперемии слизистой миндалин дужек и задней стенки глотки, шейного лимфаденита. Считается, что внутриутробное инфицирование энетровирусами может послужить причиной синдрома внезапной детской смерти. Также доказана связь между энтеровирусной инфекцией у детей и развитием сахарного диабета 1 типа.

Кроме общей симптоматики, в клинике различных форм энтеровирусной инфекции у детей присутствуют свои специфические проявления.

Энтеровирусная лихорадка у детей (малая болезнь, летний грипп, трехдневная лихорадка) вызывается разными серотипами вирусов Коксаки и ECHO. Для инфекции характерна острая манифестация с лихорадки, миалгии, умеренных катаральных явлений. У ребенка выражены общие признаки энтеровирусной инфекции: инъекция сосудов склер, гиперемия лица, увеличение лимфоузлов и др.; может отмечаться увеличение печени и селезенки. Данная форма энтеровирусной инфекции у детей протекает легко, обычно не более 2-4 дней. В редких случаях энтеровирусная лихорадка продолжается 1-1,5 недели или имеет волнообразное течение.

Кишечная (гастроэнтеритическая) форма энтеровирусной инфекции чаще встречается у детей до 3-х лет. Заболевание протекает с незначительными катаральными явлениями (ринитом, заложенностью носа, гиперемией слизистых ротоглотки, кашлем) и диспепсическим синдромом (диареей, рвотой, метеоризмом). Тяжелая интоксикация, дегидратация и явления колита не свойственны. Продолжительность кишечной формы энтеровирусной инфекции у детей составляет 1-2 недели.

Катаральная (респираторная) форма энтеровирусной инфекции у детей протекает по типу ОРЗ. Отмечается кратковременная лихорадка, ринофарингит, ларингит. Возможно развитие синдрома ложного крупа.

Энтеровирусная экзантема, ассоциированная с ECHO и Коксаки-вирусами, характеризуется появлением на высоте лихорадки кожной сыпи. По характеру сыпь может напоминать таковую при скарлатине, кори или краснухе; элементы располагаются преимущественно на коже лица и туловища. Реже встречаются пузырьковые высыпания в полости рта, напоминающие герпес (пузырчатка полости рта). Течение энтеровирусной инфекции у детей благоприятное; сыпь и лихорадка исчезают в течение 1-2 дней.

Эпидемическая миалгия (болезнь Борнхольма, плевродиния) – энтеровирусная инфекция у детей, вызываемая Коксаки и ECHO-вирусами. Ведущим проявлением заболевания служат интенсивные мышечные боли, сопровождающие высокую лихорадку. Чаще дети жалуются на боли в грудной клетке и верхней половине живота, реже – в спине и конечностях. При движении боли усиливаются, вызывая побледнение кожных покровов, обильное потоотделение, тахипноэ. Эпидемическая миалгия требует проведения дифференциальной диагностики с плевритом, острым аппендицитом или перитонитом. Вне болевого приступа дети чувствуют себя значительно лучше. Данная форма энтеровирусной инфекции у детей нередко протекает совместно с герпангиной и серозным менингитом.

Серозный менингит является типичной формой энтеровирусной инфекции у детей. Клиническая картина характеризуется высокой температурой тела, сильной головной болью, повторной рвотой, беспокойством и возбуждением ребенка, бредом и судорогами. Со стороны респираторного тракта отмечаются явления фарингита. С первых дней выражены менингеальные симптомы: положительные симптомы Брудзинского и Кернига, ригидность мышц затылка. Обычно через 3-5 дней симптоматика регрессирует, однако постинфекционная астения и остаточные явления могут сохраняться в течение 2-3 месяцев.

Полиомиелитоподобная (паралитическая) форма энтеровирусной инфекции у детей является одной из наиболее тяжелых. Как и при полиомиелите, повреждение передних рогов спинного мозга может приводить к развитию вялых параличей и парезов нижних конечностей. В легких случаях прихрамывающая походка, слабость в ногах, снижение мышечного тонуса являются обратимыми и постепенно исчезают через 4-8 недель. При тяжелых формах энтеровирусной инфекции у детей возможен летальный исход вследствие нарушением функции дыхательного и сосудодвигательного центров.

Энцефаломиокардит новорожденных вызывается вирусами Коксаки типа В и характерен для недоношенных и детей первых месяцев жизни. На фоне общей симптоматики (вялости, отказа от груди, субфебрилитета) нарастают явления сердечной недостаточности (тахикардия, одышка, цианоз, аритмия, расширение границ сердца и печени). При энцефалите развивается выбухание родничков и судороги. Летальность при данной форме энтеровирусной инфекции среди детей достигает 60-80%.

Геморрагический конъюнктивит вызывается энтеровирусом типа 70. Проявляется светобоязнью, слезотечением, ощущением инородного тела в глазах. Объективно определяются отек и гиперемия конъюнктивы, точечные кровоизлияния. При присоединении вторичной инфекции может развиваться бактериальный конъюнктивит, кератит. Обычно все симптомы энтеровирусной инфекции у детей стихают через 10-14 дней.

Энтеровирусный увеит преимущественно поражает детей 1-го года жизни. Данная форма энтеровирусной инфекции протекает с лихорадкой, интоксикацией, кишечным и респираторным синдромом. Поражение сосудистой оболочки глаза носит стойкий характер и может привести к дистрофии радужки, помутнению роговицы, развитию увеальной катаракты и глаукомы, субатрофии глазного яблока.

Особенности течения герпетической ангины проанализированы в соответствующем обзоре.

Диагностика энтеровирусной инфекции у детей

Энтеровирусные инфекции у детей диагностируются на основании типичного симптомокомплекса с учетом сезонности и эпидемиологических данных. Обязательным для установления диагноза является лабораторное подтверждение энтеровирусной инфекции у детей: обнаружение РНК энтеровируса методом ПЦР, определение титра специфических антител с помощью ИФА, РСК или РПГА и др.

Лабораторная верификация возбудителей может проводиться в различных биологических жидкостях: в крови, отделяемом конъюнктивы, смыве из носоглотки, соскобах с кожных высыпаний, образцах фекалий, спинномозговой жидкости (при наличии показаний для люмбальной пункции), биоптатах органов и др.

В зависимости от ведущего клинического синдрома дети могут нуждаться в консультации педиатра, детского кардиолога, детского невролога, детского отоларинголога, детского офтальмолога и др. специалистов. Различные формы энтеровирусной инфекции у детей требуют проведения дифференциальной диагностики с полиомиелитом, корью, краснухой, скарлатиной, эпидемическим паротитом, ОРВИ, ОКИ.

Лечение энтеровирусной инфекции у детей

Лечение легких изолированных форм энтеровирусной инфекции у детей проводится амбулаторно; госпитализация требуется при серозном менингите, энцефалите, миокардите, тяжелых комбинированных поражениях. В лихорадочном периоде показаны покой, постельный режим, достаточный питьевой режим.

Этиопатогенетическая терапия энтеровирусной инфекции у детей включает применение рекомбинантных интерферонов (альфа интерферона), интерфероногенов ( оксодигидроакридинилацетата, меглюмина акридонацетата), полиспецифических иммуноглобулинов (при тяжелом течении).

При миокардите, менингите и др. формах показано назначение глюкокортикостероидов. Одновременно проводится симптоматическое лечение (прием жаропонижающих, дезинтоксикационная терапия, орошение полости носа, полоскание зева и др.).

Прогноз и профилактика энтеровирусной инфекции у детей

В большинстве случаев энтеровирусная инфекция у детей заканчивается реконвалесценцией. Наиболее серьезными в отношении прогноза являются энтеровирусные энцефалиты, энцефаломиокардиты новорожденных, менингиты, генерализованная инфекция, присоединение бактериальных осложнений.

Дети, заболевшие энтеровирусной инфекцией, подлежат изоляции; на контактных лиц накладывается карантин на 2 недели. В эпидемиологическом очаге проводятся дезинфекционные мероприятия. Ввиду большого разнообразия энтеровирусов специфическая вакцина против инфекции не разработана. Неспецифическая профилактика включает эндоназальную инстилляцию лейкоцитарного интерферона детям и взрослым, контактировавшим с больным энтеровирусной инфекцией.

Роспотребнадзор и Ростуризм проверят курорты Турции из-за вируса Коксаки — Общество

ВЛАДИВОСТОК, 6 сентября. /ТАСС/. Роспотребнадзор и Ростуризм на следующей неделе проведут инспекцию курортов Турции из-за вируса Коксаки, сообщила журналистам глава Роспотребнадзора Анна Попова в кулуарах Восточного экономического форума.

«Мы выезжаем туда с нашим визитом, который, собственно, готовили давно, но турецкая сторона не могла принять нашу команду в связи с религиозным праздником (Курбан-байрам — прим. ред.)… Мы выезжаем на следующей неделе, мы пригласили с собой Ростуризм», — сказала она.

Попова уточнила, что проверка будет проводиться в местах, в которых зафиксировано наибольшее количество обращений. «Мы выезжаем туда посмотреть, как организована работа и как это происходит, как вообще работают в отелях по обеспечению безопасности здоровья в части инфекционных болезней туристов Российской Федерации», — подчеркнула глава Роспотребнадзора.

Кроме того, по ее словам, предметом обсуждения с турецкими коллегами станет и лабораторная диагностика. «Пока эти вопросы абсолютно не прозрачны и не ясны — как это происходит, кому ставится какой диагноз и на каком основании», — отметила Попова.

Глава ведомства добавила, что также Роспотребнадзор пристально следит за каждым случаем заболевания российских туристов, которые выехали в Турцию после 11 августа. «Меры будут нещадны к тем туроператорам, к тем туркомпаниям, к тем турагентам, которые позволили себе не уведомить должным образом туриста об имеющейся угрозе», — сказала глава Роспотребнадзора.

Информация о заболевших

По данным МИД РФ на 4 сентября, почти 60 россиян, в основном детей, заразились вирусом Коксаки в провинции Анталья с июля 2017 года.

Роспотребнадзор 11 августа признал условия на юге Турции небезопасными для российских туристов. В Ростуризме поддержали это решение и напомнили, что граждане, купившие туры на юг Турции, могут в досудебном порядке потребовать расторжения договора и компенсации расходов в связи с опасностью вирусной инфекции.

Ранее в СМИ появилась информация о распространении среди отдыхающих на турецких курортах энтеровирусной инфекции — вируса Коксаки, из-за чего многие туристы были вынуждены прервать отдых. Вирус Коксаки относится к энтеровирусным инфекциям, которые хорошо переносят низкие температуры, сохраняются в воде. Источником инфекции является только человек — больной или здоровый носитель. Вирус в основном заражает маленьких детей при попадании с водой, пищей, через грязные игрушки, руки.

Вирус Коксаки заподозрили в «чёрном» пиаре Турции в пользу российских курортов

Сообщения СМИ о «массовых случаях» заражения вирусом Коксаки в Турции турбизнес признал фальсификацией – реальные факты раздуты явно для того, чтобы очернить турецкое направление в пользу конкурентов. Участники туррынка признают, что отдельные случаи этого заболевания действительно встречаются, и эксперты даже называют конкретные отели, где такие факты имеют место. Однако говорить о массовости данного заболевания, а тем более об эпидемии, пока явно преждевременно: ни о каких «сотнях случаев» заражения, которыми пугает телевидение, речи не идет, при этом заболевание концентрируется в отдельных отелях.

«Информационная кампания» по поводу вируса Коксаки стартовала в российских СМИ в понедельник. Опираясь на показания заболевших в Турции, но уже вернувшихся туристов, телевидение выдавало информацию о «многих сотнях» пострадавших россиян и начале эпидемии. «За период с 30 июля до утра 31 июля в больницу, в которую я попала, было принято 60 туристов с похожими симптомами — боли в желудке, тошнота, а в некоторых случаях рвота с кровью, а также понос. Известно, что среди пострадавших, обратившихся в эту больницу за данный период, есть представители таких сетей отелей как Botanik, Larisa, Rose», — например, заявила «Известиям» туристка из Кемера.

По распространяемой информации болезнь очень заразна: начинается как обычное ОРВИ, потом усугубляется высокой температурой, проблемами с желудком, рвотой и диареей, и долго не проходит. Также появляются характерные высыпания на коже, по которым и диагностируется вирус.

Также СМИ сообщают, что Генконсульство РФ в Анталии опровергло в информацию о начале эпидемии энтеровирусной инфекции Коксаки в Турции. По информации дипломатов, случаи являются единичными. Запрос Минздраву Турции о случаях заболевания вирусом Коксаки на курортах страны направил во вторник и Роспотребнадзор. При этом ведомство отмечает, что в летне-осенний период заболеваемость энтеровирусными инфекциями растет ежегодно. Одновременно Роспотребнадзор открыл горячую линию для туристов «для оценки ситуации». Ведомство просит указывать в обращении период нахождения туристов в Турции, дату ухудшения самочувствия, симптомы заболевания, контактные данные, место отдыха и название отеля, дату возвращения в Россию и состояние здоровья после возвращения.

Эксперты туррынка не отрицают, что факты заболевания есть, однако ни о каких «сотнях» заболевших речи, по их словам, не идет. В соцсетях, где ситуацию обсуждают турагентства, комментарии «с полей» разнообразны. «2 семьи с детьми вернулись из Маритима позавчера. Ни один человек из 7-х ничего не подхватил, более того и не знал, что там где-то вспышка». «У меня туристы сейчас находятся в отеле Белека. У них несколько дней назад заболел ребёнок вирусом Коксаки (это наподобие ветрянки, с высокой температурой, которая плохо сбивается и во рту и по телу прыщики). Ребёнку есть больно. В отеле, кто не заболел, мечтают быстрее уехать». Однако общий итог примерно такой: «Где отдыхает больше всего наших граждан этим летом? Правильно, в Турции. Соответственно, по теории больших чисел, и случаев всяческих заболеваний больше там же», — отмечают сотрудники турагентств. Кроме того новость традиционно назвали «черным пиаром» в пользу отечественных курортов.

«От других участников рынка информация такова – практически все, не сговариваясь, говорят, что у них есть один-два случая, но речь явно не идет ни о десятках, ни о сотнях туристов. В основном «страдают» более-менее дешевые отели уровня трех звёзд», — прокомментировал корреспонденту инфогруппы «ТУРПРОМ» известный эксперт по Турции Геннадий Косарев. Основной причиной этого заболевания в самой Турции называют, по данным собеседника, сочетание жары, большого количества туристов и проблем с дезинфекцией воды в бассейнах. «Причем эта ситуация встречается не первый год, в августе ситуация с ростом заболеваний случается регулярно. Просто в прошлом году наших туристов в это время в Турции ещё практически не было, и СМИ успели об этой теме забыть. Как только жара в +34-36 градусов спадет, ситуация улучшится», — отметил Геннадий Косарев.

«Жаркий летний период – это действительно идеальное время для распространения вирусных заболеваний, особенно на курортах, куда съезжаются многочисленные отдыхающие. Но мы совсем не видим причин для паники. К нам жалоб от туристов не поступало, как и случаев аннуляций туров в связи с информацией о вспышке Коксаки», — также прокомментировали ситуацию в пресс-службе туроператора НТК «Интурист». Массовых отказов от путевок не фиксируют также и в РСТ.

«Что касается отелей, в которых отдыхают туристы туроператора TUI – в целом ситуация спокойная, на данный момент информация в сми о массовости проблемы и эпидемии —  преувеличена. У нас есть единичные обращения туристов о досрочном возврате из-за болезни, что в целом характерно для разгара летнего сезона, к сожалению такие заболевания возникают каждый сезон на курортных побережьях. Уже после новостей в сми, нам поступают звонки от туристов, которые только собираются на отдых, мы всем даем актуальную информацию, основываясь на данные наших турецких партнеров, говорим о мерах предосторожности, также рекомендуем ориентироваться на сообщение Ростуризма о том, что эпидемии не зафиксировано», — сообщили в пресс-службе туроператора.

В туроператоре TEZ-tour также сообщили, что согласно данным их принимающей компании, ситуация на «эпидемию» не тянет. «По нашим данным страховые компании фиксируют единичные случаи обращений по заражению вирусом Коксаки», — отметили в пресс-службе туроператора. При этом эксперты предупредили туристов и дали им ряд советов по заботе о здоровье. «Планируя отпуск с детьми следует помнить, что июль-август – сезон распространения энтеровирусных инфекций, особенно на южных курортах, где жара и скопление людей создают для этого благоприятные условия. Чаще всего инфекции подвержены дети до 5 лет», — подчеркнули в TEZ-tour. И, хотя турецкие отели в этот период времени обычно принимают повышенные профилактические меры — шоковую дезинфекцию бассейнов, детальную и дополнительную к стандартной дезинфекцию в номерах, клубах, на кухне и ресторанах, туристам всё же рекомендуют позаботиться о своей безопасности и самостоятельно. «Главные профилактические меры для туристов – соблюдать личную гигиену, часто мыть руки, использовать антибактериальные спреи, не глотать воду в бассейне. Важно также понимать ответственность заболевшего в распространении инфекции, и если эта неприятность произошла с туристами, обязательно стоит после обращения к врачу по медицинской страховке оставаться в номере, проявляя таким образом уважение к чужому здоровью», — резюмировали в Tez-tour.

Добавим, что любое турагентство может бесплатно разместить на своём сайте виджет погоды в виде красивой интерактивной карты, тем самым серьёзно улучшив восприятие своего интернет-ресурса со стороны потенциальных туристов. Так, если у вас на сайте есть разделы, посвященные Турции, то вставьте туда следующие виджеты:

А также виджет местной валюты:

  • Турция: виджет курса турецкой лиры

https://www.tourprom.ru/information/currency/turkey/widget/

И виджет местных достопримечательностей:

Осторожно, энтеровирус! Для кого инфекция может быть опасна? | ЗДОРОВЬЕ

Для кого может быть опасен энтеровирус и как им можно заразиться, разбирался корреспондент omsk.aif.ru.

«Вся страна была взбудоражена по поводу обнаружения в Турции вируса Коксаки, якобы это новый энтеровирус, однако это не так. Энтеровирусы были открыты в 60-х годах прошлого века американскими учёными. С тех пор все они хорошо изучены. Энтеровирусы циркулируют во всех странах и континентах и встречаются на растительности, почве и в воде», — пояснила главный специалист-эксперт отдела эпидемиологического надзора Управления Федеральной службы Роспотребнадзора по Омской области Наталья Анпилова.

Изученный вирус

У энтеровирусной инфекции много разновидностей. Всего их около 100, включая Коксаки. От вида вируса эффективность лечения не зависит, — каждый из них вылечить достаточно просто. Вакцина от них не разработана, так как их слишком много.

Источниками и переносчиками вируса являются здоровые взрослые люди. Это – одна из его особенностей. У человека энтеровирусы живут в кишечнике и слизистой оболочке носоглотки. Большинство заболевших – дети от 0 до 14 лет.

«Мы знаем, когда ожидать подъём заболеваемости. Как правило, это период с июля по октябрь», — добавила Наталья Анпилова.

Ежегодно главный санитарный врач страны издаёт постановление, какие меры профилактики необходимо соблюдать руководителям детских учреждений. В первую очередь воспитатель в детском саду или учитель в школе не должны допускать заболевших к занятиям, чтобы не заразить других детей.

Симптомы заболевания

В зависимости от состояния организма, энтеровирусная инфекция может проявляться у каждого по-разному.

«Симптомы могут различаться, но основное заболевание, которое вызывает интерес в связи с данной инфекцией – вирусный менингит, то есть воспаление мозговых оболочек.   Клиника вирусного менингита заключается в том, что у ребёнка появляется головная боль, сопровождающаяся рвотой и повышением температуры до 39-40 градусов», — поясняет заместитель главного врача БУЗОО «Городская детская клиническая больница № 3» Людмила Безрукова.

По её словам, если у ребёнка возникли подобные симптомы, необходимо срочно обратиться к врачу. Если энтеровирусная инфекция подтверждается, ребёнку требуется госпитализация. Как правило, при своевременном лечении осложнения развиваются крайне редко.

Еще одно последствие – экзантема, то есть сыпь на теле. Также  она может проявиться как острое респираторное вирусное заболевание.

Контактно-бытовой путь передачи

Основной путь заражения – контактно-бытовой. Поэтому основная профилактика заболевания энтеровирусной инфекцией – соблюдение правил личной гигиены. Их знаю все: мыть руки перед едой, мыть фрукты и овощи, не находиться рядом с человеком, болеющим ОРЗ и так далее.

«Когда мы приходим в детский сад с проверкой, мы смотрим, как проводится дезинфекция посуды, игрушек и поверхностей. Если вирусы есть в окружающей среде, их можно убрать дезинфицирующими растворами. Таким образом предупреждаются групповые заболевания у детей», — уточнила Наталья Анпилова.

Многие боятся из-за энтеровируса посещать бассейны, однако делать этого не стоит: в этом году его не обнаружили ни в одном бассейне или аквапарке Омской области.

В этом году случаев заражения инфекцией детьми в детских дошкольных и средних образовательных учреждениях Омской области не было зарегистрировано, а число заболевших не превышает уровень заболеваемости прошлого года.

Вирус Коксаки при беременности. Кто сталкивался?

и ещё нашла вот эту инфу…

У 120 беременных женщин с УЗМВУИ (1-я
группа) и у 20 здоровых беременных женщин (2-я
группа) было проведено вирусологическое и цито-
химическое обследования. Следует отметить, что
45% женщин 1-ой группы перенесли острые респи-
раторные заболевания за 2-4 недели до выявления
УЗМВУИ. При исследовании клеток осадка мочи
методом непрямой иммунофлюоресценции у жен-
щин 1-ой группы значительно чаще, чем у женщин
2-ой группы выявлялись антигены респираторных
вирусов: гриппа А и В (35% и 5% соответственно),
парагриппа (37,5% и 10%), РС-вируса (25% и 5%),
а также вирусов других групп: Коксаки В (70% и
15%), цитомегалии (55% и 25%), герпеса (53,3% и
25%). При вирусологическом обследовании мето-
дом ПЦР нуклеотидные последовательности виру-
сов цитомегалии, герпеса и энтеровирусов выяв-
лялись также чаще у женщин 1-ой группы.
При цитохимическом обследовании митохонд-
риальные ферменты лимфоцитов периферической
крови – сукцинатдегидрогеназа (СДГ) и ‹глицеро-
фосфатдегидрогеназа (‹-ГФДГ) — у 80% женщин 1-ой
группы превышали нормативные значения, то есть
были активированы. Как правило, это свидетельс-
твует об активном инфекционном процессе. У жен-
щин 2-ой группы эти показатели были в норме или
незначительно снижены.
Женщинам с УЗМВУИ проводилась противови-
русная терапия препаратами человеческого высоко-
очищенного иммуноглобулина для внутривенного
введения. У 80% пациенток использовался иммуног-
лобулин производства Нижнего Новгорода в дозе
25мл трижды с интервалом 1 день. У 20% пациенток
применялись иммуноглобулины зарубежных произ-
водителей (интраглобин, октагам, гамиммун) в дозе
50 мл 2-3 раза с интервалом 1-2 дня. Всем женщинам
1-ой группы назначалась индивидуальная метабо-
лическая терапия соответственно показателям СДГ
и ‹ -ГФДГ в течение 2-3 месяцев.
В процессе лечения частота УЗМВУИ снизилась
более, чем в 2 раза (на 58%), полностью исчезли рас-
ширение боковых желудочков и кисты сосудистых
сплетений головного мозга плода. При повторном
вирусологическом обследовании значительно сни-
зилась суммарная активность смешанных вирусных
инфекций. Беременность закончилась своевремен-
ными родами у 95% женщин 1-ой группы и у 100%
женщин 2-ой группы, перинатальных потерь не
было, дети не имели тяжелой патологии..

границ | Анализ генома изолятов вируса Коксаки А4, выявленных при заболеваниях рук, ног и рта в Шаньдуне, Китай

Введение

Энтеровирусы человека (EV), вирусы с одноцепочечной РНК без оболочки, таксономически классифицируются по роду Enterovirus (Dalldorf, 1953), семейству Picornaviridae и состоят из четырех видов: EV-A, EV-B, EV-C, и EV-D (Ноулз и др., 2012). Вирус Коксаки A4 (CVA4), представитель вида EV-A, в настоящее время состоит из 25 типов, включая общие возбудители энтеровируса A71 (EVA71) и вируса Коксаки A16 (CVA16), которые являются наиболее распространенными агентами, выделенными в педиатрических случаях кистей рук и ног. Болезнь рта (HFMD), распространенное инфекционное заболевание среди детей, которое спорадически встречается во всем мире (Wang et al., 2017).

Штамм-прототип CVA4, High Point (инвентарный номер GenBank: AY421762), был впервые выделен из городских сточных вод во время вспышки полиомиелита в Северной Каролине, США, в 1948 году (Melnick, 1950; Oberste et al., 2004). В Carey and Myers (1969) другой штамм CVA4 был выделен из сыворотки крови ребенка со смертельным исходом, отмеченным тяжелыми проявлениями центральной нервной системы. В Estrada Gonzalez and Mas (1977) было обнаружено, что CVA4 был связан с возникновением острого полирадикулоневрита.Примечательно, что CVA4 также упоминался как патоген во вспышках HFMD (Hu et al., 2011). Также сообщалось о связи между инфекцией CVA4 и герпангиной (Cai et al., 2015), синдромом кожно-слизистых лимфатических узлов (Ueda et al., 2015) и двусторонним идиопатическим васкулитом сетчатки (Mine et al., 2017). Эти клинические данные подчеркивают, что инфекции CVA4 представляют собой бремя болезней для глобального общественного здравоохранения, особенно для новорожденных и маленьких детей, что требует более глубокого понимания генетического разнообразия этого патогена.

Несколько полных геномов штаммов CVA4 были секвенированы до 2004 г. и были преимущественно из Азии и США (Oberste et al., 2004). Однако в 2004 и 2006 годах CVA4 вызвал две эпидемии HFMD на Тайване (Chu et al., 2011). После 2006 г. большее количество штаммов CVA4 было выделено в Европе и Азии, в основном из Китая. Например, в семи образцах от пациентов с острым вялым параличом (ОВП) в провинции Шэньси, собранных в период с 2006 по 2010 год, была диагностирована инфекция CVA4 (Wang et al., 2016). С 2008 г. преимущественно частичный VP1 и гораздо меньшее количество полных последовательностей генома нескольких штаммов CVA4 были зарегистрированы в клинических образцах из педиатрических случаев HFMD в материковом Китае, таких как Gansu (Liu et al., 2009), Shenzhen (Hu et al. ., 2011; Cai et al., 2015), Гуандун (Zhen et al., 2014) и Пекин (Li et al., 2015).

Геном РНК CVA4 (~ 7434 нуклеотида) можно подразделить на 5′-нетранслируемую область (UTR), 3′-UTR и открытую рамку считывания (ORF) (~ 6606 нуклеотидов), кодирующую один полипротеин, содержащий четыре структурных белки (VP4, VP2, VP3 и VP1 в области P1) и семь неструктурных белков (2A, 2B и 2C в области P2 и 3A, 3B, 3C и 3D в области P3).Ген VP1 обычно используется для таксономической классификации типов EV в пределах рода Enterovirus (Palacios et al., 2002). В настоящее время в базе данных GenBank доступно несколько полноразмерных последовательностей генома CVA4 (n = 10), что ограничивает понимание эволюции генома CVA4 и требует более глубокого понимания генетического разнообразия этого патогена для обеспечения доказательной базы для рациональных разработка молекулярной диагностики, разработка лекарств и дизайн вакцин.

В настоящем исследовании мы описываем полноразмерные последовательности генома (n = 21) изолятов CVA4 от педиатрических пациентов с HFMD из провинции Шаньдун, Китай, идентифицированные между 2014 и 2016 годами, а также филогенетические и молекулярные характеристики последовательностей VP1 CVA4 (n = 175 ).Эти результаты углубляют наше понимание разнообразия и эволюции CVA4 и имеют важное значение для снижения глобального бремени болезней, связанных с этим патогеном.

Материалы и методы

Клинические образцы

В этом исследовании образцы стула у детей младше 6 лет с HFMD были собраны в период с 2014 по 2016 год, а клинические образцы, которые были лабораторно подтверждены как инфекции, не связанные с EVA71 и CVA16, были любезно предоставлены Шаньдун. Центр по контролю и профилактике заболеваний.

Выделение CVA4 и извлечение РНК из клинических образцов

Клетки рабдомиосаркомы человека (RD) выращивали в MEM (минимальная необходимая среда, Gibco) с добавлением 10% FBS (фетальная бычья сыворотка, Gibco), 50 МЕ / мл пенициллина и 50 мкг / мл стрептомицина. Образцы трижды размножали в клетках RD человека при 37 ° C во влажной атмосфере при 5% CO 2 .

Суммарную РНК экстрагировали из супернатанта RD после развития цитопатического эффекта (CPE) с использованием набора RNAiso Plus (TaKaRa, 9109).РНК подвергали обратной транскрипции в кДНК с использованием случайных гексамеров с помощью набора реагентов PrimeScript RT (TaKaRa, RR037A). Анализ ПЦР в реальном времени на основе TaqMan проводился для обнаружения присутствия ЭВ с использованием системы ПЦР в реальном времени ABI 7500, как описано ранее (Zhang et al., 2017a, b). EV-положительные образцы (n = 21) были секвенированы с использованием платформы высокопроизводительного секвенирования MiSeq, а данные секвенирования были проанализированы с использованием программы CLC для получения полных последовательностей вирусного генома. Образцы без EVA71 и без CVA16 из случаев HFMD были дополнительно протестированы с помощью CVA4-специфичного ПЦР-анализа в реальном времени с использованием олигонуклеотидных праймеров и зонда, разработанного на основе гена VP1 прототипного штамма CVA4 (номер доступа в GenBank: AY421762): CVA4- F: TATGGGCTTTGTCCAACTCC, CVA4-R: GTCTAGGGACCCATGCCCTCACT, CVA4-зонд: FAM-TGGGGACATTTTCAGCTAGAGTTGTGAGCAAG-BHQ1.

Филогенетический анализ CVA4

Для филогенетического анализа из GenBank были загружены два набора данных, включающие все доступные полные геномные последовательности (n = 10) и полноразмерные последовательности гена VP1 (n = 154) штаммов CVA4. Множественное выравнивание последовательностей для двух наборов данных было выполнено с использованием Muscle (Edgar, 2004) вместе с геномами, секвенированными по Шаньдунскому CVA4 (n = 21). Модель нуклеотидного замещения была выбрана с помощью jModeltest (Darriba et al., 2012), а общая модель обратимого времени (GTR) всегда была лучшей моделью для анализа обоих наборов данных.Филогенетический анализ двух наборов данных был проведен с использованием RAxML v8.1.6 (Stamatakis et al., 2005) с моделью нуклеотидных замен GTRGAMMA с 1000 повторениями начальной загрузки. Нуклеотидные и аминокислотные расстояния оценивали с помощью MEGA 5 (Tamura et al., 2011).

Генетическое разнообразие по генам полипротеина CVA4

Среднее попарное генетическое разнообразие геномов CVA4 было рассчитано с помощью Phylip со скользящим окном в 300 нуклеотидов и размером шага в 50 нуклеотидов (Faria et al., 2017). Чтобы определить, в каком сайте кодонов чаще всего встречаются нуклеотидные вариации, энтропия Шеннона (Sn) в положениях 1, 2 и 3 каждого кодона выровненных генов полипротеинов и VP4, VP2, VP3, VP1, 2A, 2B, Гены 2C, 3A, 3B, 3C и 3D, соответственно, были рассчитаны, как сообщалось ранее (Ramirez et al., 2013). Обработка данных выполнялась в среде R с открытым исходным кодом (R Development Core Team, 2012) с использованием пакета ggplot2.

Эволюционная динамика глобальных штаммов CVA4

Для определения структуры, подобной молекулярным часам, в данных CVA4 VP1, дерево максимального правдоподобия последовательностей гена VP1, оцененное на предыдущем этапе, было использовано для изучения связи между расхождением последовательностей и временем выборки с помощью TempEst (Rambaut et al., 2016). Чтобы лучше понять эволюционную динамику CVA4, набор данных последовательности VP1 (n = 175) использовался для оценки скорости нуклеотидных замен с использованием выборки методом байесовской цепи Маркова (MCMC), реализованной в пакете BEAST v1.8.4 (Drummond and Rambaut, 2007). ). Модель SRD09 была использована в качестве модели нуклеотидного замещения. Байесовский процесс MCMC выполнялся для 100 миллионов шагов с частотой дискретизации каждые 5000 шагов, и первые 10% шагов отбрасывались как выгорание.Чтобы выбрать лучшую комбинацию молекулярных часов и предшествующего дерева, использовались как выборка пути, так и выборка ступеньки (Baele et al., 2012). Лучшая комбинация моделей — это предшествующее байесовское дерево горизонта и некоррелированная расслабленная модель молекулярных часов с логарифмически нормально распределенными вариациями скоростей между ветвями (дополнительная таблица S1) (Drummond et al., 2005). Апостериорные распределения оценивались с помощью Tracer v1.6, где предполагаемый размер выборки (ESS) составлял не менее 200. Байесовское дерево максимального доверия (MCC) было создано с помощью TreeAnnotator v1.8.4, а затем визуализировали с помощью FigTree v1.4.3. Кроме того, мы выполнили байесовский анализ графика горизонта с помощью программы Tracer v1.6 для реконструкции эволюционной истории на основе 175 полноразмерных последовательностей гена VP1 штаммов CVA4.

Результаты

Сводка набора данных

В этом исследовании в общей сложности 21 штамм CVA4 был выделен из образцов стула пациентов с HFMD в провинции Шаньдун, в том числе пять из Ляочэна, три из Хэцзэ, по два из Дэчжоу, Линьи, Вэйхай, Яньтай и отдельные образцы из Биньчжоу, Лайу и др. Тайан, Циндао и Жичжао (рис. 1 и дополнительная таблица S2).Полногеномные последовательности 21 изолята были депонированы в базу данных GenBank: MH086030-MH086050 (дополнительная таблица S2).

Рисунок 1. Филогенетическое дерево максимального правдоподобия последовательностей полного генома CVA4 (n = 31). 21 изолят CVA4, описанный в этом исследовании, окрашен в розовый цвет, а узлы эталонных красителей, загруженных из GenBank, окрашены в сиреневый. Три клады (I, II и III) окрашены в синий, фиолетовый и светло-зеленый цвета, а штамм-прототип CVA4 High Point (AY421762) окрашен в красный цвет.

Десять полных геномов CVA4 в период с 1948 по 2015 год были общедоступны в GenBank, восемь штаммов из Китая и два из США. Были также получены последовательности полноразмерных штаммов гена VP1 CVA4 (n = 175). Они были изолированы от Азербайджанской Республики (n = 1), Китая (n = 145), Индии (n = 8), Кении (n = 1), России (n = 15), Туркменистана (n = 1) и США (n = 4) (дополнительный рисунок S1), соответственно. Даты сбора варьировались с 1948 по 2016 год (дополнительный рисунок S1).Примечательно, что 94,9% (n = 166) из них были отобраны с 2006 г., а 84,9% (n = 141) были собраны из 16 провинций и городов Китая, включая Шаньдун (n = 60), Сычуань (n = 18), Пекин ( n = 14), Шанхай (n = 11), Шэньчжэнь (n = 9), Хунань (n = 7), Юньнань (n = 4), Чунцин (n = 4), Цзилинь (n = 3), Нинся (n = 2), Цзянсу (n = 2), Хайнань (n = 2), Гуандун (n = 2), Аньхой (n = 1), Хэнань (n = 1) и Чжэцзян (n = 1).

Филогенетическая характеристика CVA4

Филогенетический анализ 31 целого генома показал, что 21 изолят из настоящего исследования разделились на три строго поддерживаемые клады (рис. 1).17 штаммов были локализованы в основной кладе вместе с семью китайскими штаммами, собранными в период с 2008 по 2011 гг. Два изолята, SDLC / 16114 / China / 2016-05-08 и SDQD / QD384R / China / 2016-06-17, сгруппированы в одну независимую кладу а изоляты SDLY / 2014LY124R / China / 2014-04-23 и SDHZ / h437 / China / 2015-04-28, а также ранее описанные KP289442 / P1033 / 2013 / China / 2013 принадлежали к отдельной третьей кладе. Кроме того, 21 шаньдунский изолят имел более высокую гомологию нуклеотидных последовательностей с восемью ранее описанными китайскими штаммами (82.0–99,8%), чем с штаммом-прототипом High Point / United States / 1948 (77,8–79,3%) и американским штаммом 2015-OB2038 / TN / United States / 2015-04-16 (75,5–78,3%).

В дереве максимального правдоподобия генов VP1 (дополнительный рисунок S2) изоляты CVA4 были разделены на четыре высоко поддерживаемых генотипа: A (n = 1), B (n = 1), C (n = 28) и D ( n = 145). Прототип штамма High Point, выделенный из США в 1948 году, был классифицирован как генотип A, а один изолят из Кении в 1999 году был обозначен как генотип B.Штаммы CVA4 с генотипом C были собраны в России в 2006–2014 гг. (N = 14), в Индии в 2010 г. (n = 8), в США в 1999 г. (n = 1) и 2015 г. (n = 1), в провинции Сычуань. , Китай в 2006 г. (n = 1) и 2007 г. (n = 1), Азербайджан (n = 1) и Туркменистан (n = 1), соответственно. Поразительно, но генотип D был преобладающим генотипом в Китае. Генотип D можно разделить на два субгенотипа с высокой степенью поддержки: D1 (n = 5) и D2 (n = 140). Более подробно, пять китайских штаммов, выделенных до 2006 года, принадлежали к субгенотипу D1, а остальные китайские штаммы сгруппированы в субгенотипе D2, включая 21 изолят, описанный в настоящем исследовании.Однако наши секвенированные штаммы не группировались вместе, а были вкраплены в субгенотип D2. Примечательно, что был один штамм CVA4 из России, KC879539 / 40238 / Russia / 2011, подпадающий под субгенотип D2 и обладающий высокой гомологией (97,5%) с KY978552 / 11142 / SD / China / 2011.

Среднее значение между групповыми нуклеотидными и аминокислотными расстояниями составляло 21,8 и 2,4% (генотип CVA4 A против B), 22,5 и 2,8% (A против C), 21,7 и 2,3% (A против D), 28,9 и 2,6%. (B против C), 28,0 и 2,9% (B против D) и 20.4 и 3,2% (C vs. D) соответственно. Кроме того, средние нуклеотидные (и аминокислотные) расстояния между группами D1 и D2 составляли 15,2% (2,2%). Средние нуклеотидные (и аминокислотные) расстояния в группах C и D составляли 13,2% (2,8%) и 6,0% (1,3%) соответственно, т.е. 15%. Средние нуклеотидные (и аминокислотные) расстояния в группах D1 и D2 составляли 10,4% (2,0%) и 5,3% (1,2%) соответственно.

Парное генетическое разнообразие вдоль генома CVA4

Используя анализ скользящих окон по геномам CVA4 (n = 31), мы обнаружили, что попарное генетическое разнообразие в областях P2 (включая гены 2A, 2B и 2C) и P3 (включая гены 3A, 3B, 3C и 3D) был выше, чем в области P1 (включая гены VP4, VP2, VP3 и VP1) (рис. 2A).Кроме того, 3A, 3B и 3′-конец 3D показали более высокое попарное генетическое разнообразие, чем другие области гена. Ген полипротеина 21 генома CVA4 из настоящего исследования имел 82,6–99,2% гомологии нуклеотидной последовательности и соответствующую гомологию аминокислотной последовательности 97,1–99,9%, что позволяет предположить наличие многочисленных синонимичных мутаций. В соответствии с этим наблюдением, среднее значение Sn в третьем положении кодонов полипротеинового гена штаммов CVA4 было 0,224, что значительно выше, чем в положениях 1 и 2 кодонов (рис. 2В).Кроме того, средние значения Sn в третьем положении кодонов генов 2B, 2C, 3A, 3C и 3D были значительно выше, чем у генов VP1, VP2, VP3 и VP4 в области P1 (рис. 2C).

Рисунок 2. Генетическое разнообразие генов полипротеина CVA4 (n = 31). (A) Среднее попарное генетическое разнообразие всех генов полипротеина CVA4 было рассчитано с использованием скользящего окна в 300 нт с размером шага 50 нт. (B) Были оценены значения позиционной энтропии и значения Sn в разделах 1, 2 и 3 каждого кодона, соответственно. ∗∗∗ p-значение <0,001 в тесте суммы рангов Вилкоксона. (C) Значения Sn нуклеотидов в трех положениях кодонов оценивали в генах VP4, VP2, VP3, VP1, 2A, 2B, 2C, 3A, 3B, 3C и 3D соответственно. ∗∗∗ p-значение <0,001 в тесте суммы рангов Вилкоксона между генами 2B, 2C, 3A, 3C, 3D и генами VP4, VP2, VP3, VP1 соответственно.

Эволюционная динамика мирового CVA4

Байесовское филогенетическое дерево всех генов CVA4 VP1 (n = 175), реконструированное с использованием модели наилучшего соответствия, показало ту же топологию, что и филогенетическое дерево максимального правдоподобия (рис. 3).Анализ структуры молекулярных часов Tempest выявил сильную временную корреляцию в гене VP1 (R 2 = 0,86). Средняя скорость нуклеотидных замен для генов VP1 CVA4 была оценена как 5,12 × 10 -3 замен / сайт / год (95% самая высокая апостериорная плотность (HPD): 4,45 × 10 -3 –5,81 × 10 -3 замен / сайт / год). Примерно в 1941 году (95% HPD: 1931–1948) вирусы CVA4, по оценкам, разделялись на генотип A и общее происхождение генотипов B, C и D.Было высказано предположение, что генотип B отклонился от общей родословной примерно в 1951 году (95% HPD: 1933–1966), и, наконец, генотипы C и генотип D разошлись примерно в 1970 году (95% HPD: 1961–1977). Кроме того, генотип D был далее разделен на субгенотипы D1 и D2, которые произошли примерно в 1979 году (95% HPD: 1974–1985), и время до самого последнего общего предка (tMRCA) субгенотипа D2 можно было проследить. назад в 2001 г. (95% HPD: 1999–2003 гг.).

Рисунок 3. Байесовский филогенетический анализ и демографическая реконструкция последовательностей гена CVA4 VP1 (915 нт). (A) Байесовская филогения была проведена BEAST с предварительным байесовским деревом горизонта и расслабленной моделью молекулярных часов. (B) По оси абсцисс отложена шкала времени (в годах), а по оси ординат — эффективный размер популяции в логарифмической шкале Neτ. Толстая сплошная линия указывает средние оценки, а заштрихованная область указывает на 95% самую высокую апостериорную плотность.

Кроме того, мы выполнили байесовский анализ графика горизонта, чтобы восстановить демографическую историю CVA4 на основе последовательностей гена VP1 (рис. 3).Наши результаты показали, что эффективный размер популяции (аналог числа инфицированных особей) вируса CVA4 прошел пять основных стадий с момента описания прототипа штамма High Point в 1948 году (рис. 3). Первый этап охватывал период с 1948 по 2000 год, когда численность популяции была относительно постоянной, с признаками небольшого увеличения. На этом этапе генотипы B, C и D уже присутствовали до 1975 года, а также возникновение генотипа D1 в начале 1980-х и последующая совместная циркуляция генотипов B, C и субгенотипа D1.На втором этапе размер популяции резко и быстро уменьшился с 2000 г. до примерно середины 2003 г., возможно, из-за снижения распространенности генотипа B и субгенотипа D1 (или, возможно, отсутствия данных наблюдения), поскольку генотип C и субгенотип D2 разнообразились за этот период. Вскоре после середины 2003 г. численность популяции CVA4 значительно и быстро росла до 2010 г., когда широко распространялись генотип C в России и Индии и субгенотип D2 в Китае.После 2010 г. произошло еще одно резкое и резкое уменьшение эффективного размера популяции, которое могло быть вызвано снижением распространенности генотипа C. С 2011 г. CVA4, по-видимому, вступил в стадию восстановления, и размер популяции снова стал стабильным с субгенотипом. D2 доминирует в Китае.

Молекулярные характеристики

По сравнению с прототипным штаммом CVA4 High Point, 40 аминокислотных замен было идентифицировано в полипротеине в> 75% наших изолятов, в том числе 1 в VP4, 2 в VP2, 2 в VP3, 6 в VP1, 6 в 2A, 1 в 2B, 5 в 2C, 1 в 3A, 3 в 3C и 11 в 3D (дополнительная таблица S3).В EVA71 ранее сообщалось, что 14 критических аминокислотных остатков и два генных мотива связаны с вирусной инфекционностью in vitro и in vivo (Table 1) (30–43). Интересно, что штаммы CVA4 содержали те же аминокислотные остатки в нескольких сайтах, что и штамм EVA71 BrCr, такие как остатки 37, 113 и 192 белка VP1, 84, 82–86 и 154–156 белка 3C. , 73 и 363 белка 3D (таблица 1). Однако, в отличие от VP1 169L прототипа штамма EVA71, VP1 169F был обнаружен в High Point и в каждом из наших 21 изолята CVA4, что указывает на то, что CVA4, возможно, адаптировался для связывания с членом 2 класса мышиного рецептора мусорщика ( SCARB2) (Victorio et al., 2016). Примечательно, что между EVA71 BrCr и штаммами CVA4 и VP1 были разные аминокислотные остатки в VP2 149 , VP1 97 , VP1 98 , VP1 123 , VP1 167 и VP1 244 . 145K наблюдалось среди наших изолятов CVA4.

Таблица 1. Сравнение потенциальных критических аминокислотных остатков прототипных штаммов EV71 и CVA4 и 21 изолята, описанного в настоящем исследовании.

Обсуждение

Хотя EVA71 и CVA16 известны как основные возбудители HFMD в Китае, сообщалось, что ряд других видов EV-A, включая CVA6, CVA10, CVA2 и CVA4, связаны с HFMD.Кроме того, CVA4 также был одним из распространенных патогенов, связанных со случаями асептического менингита, герпетической ангины и вирусного миокардита (Carey and Myers, 1969; Estrada Gonzalez and Mas, 1977; Lee et al., 2014; Wang et al., 2016), что вызвало серьезную озабоченность в области общественного здравоохранения и вызвало предположения о том, существует ли измененный тропизм или патогенность, связанная с этим типом сердечно-сосудистых заболеваний. Однако подробный анализ генома был проблематичным, поскольку на сегодняшний день в базе данных GenBank было всего десять полных геномов CVA4 (Hu et al., 2011). Следовательно, молекулярно-эпидемиологическая характеристика CVA4 остается гораздо менее понятной из-за недостатка доступных геномных данных.

В этом исследовании мы описали 21 новый геном CVA4, выделенный от детей с HFMD, и выявили, что наши изоляты сгруппированы в три хорошо поддерживаемых клады на дереве максимального правдоподобия, оцененном с использованием полных геномов. Это свидетельствует о наличии определенного генетического разнообразия китайских вирусов CVA4, которое было бы недооценено из-за ограниченности имеющихся данных эпиднадзора.Филогенетический анализ последовательностей гена VP1 показал, что штаммы CVA4 можно разделить на четыре отдельных генотипа, A-D, со средним генетическим расстоянием в пределах генотипа 0,00–13,2% и средним значением генетического расстояния между генотипами 20,4–28,9%. Следовательно, в соответствии с предыдущими сообщениями (Rico-Hesse et al., 1987; Hu et al., 2011), различные генотипы CVA4 могут быть определены с> 15% нуклеотидного расстояния между генотипами в гене VP1. Однако, в отличие от предыдущего отчета (Hu et al., 2011), штамм-прототип High Point образовал самостоятельную ветвь как генотип А в нашей классификации. Подавляющее большинство китайских штаммов, включая 21 изолят в этом исследовании, принадлежали к генотипу D, и только два штамма, идентифицированные в провинции Сычуань в 2006 и 2007 годах, принадлежали к генотипу C. вытеснили D1 и стали преобладающими в Китае за предыдущее десятилетие.

Дальнейший анализ показал, что мутации с большей вероятностью возникли в областях P2 и P3, кодирующих неструктурные белки, и в третьей позиции кодонов, что согласуется с предыдущими сообщениями о том, что существует общий образец использования синонимичных кодонов для многих типов энтеровирусов ( Лю и др., 2011; Ma et al., 2014; Zhang et al., 2014; Су и др., 2017). Более того, ген VP1 был наиболее консервативной областью в нашем анализе, что позволяет предположить, что он может быть потенциальной мишенью для разработки чувствительного и специфичного к CVA4 диагностического анализа RT-qPCR, а также может быть эпитопом-кандидатом для разработки вакцин.

С середины 1950-х годов генетическое разнообразие CVA4 постепенно увеличивалось с 1948 по 1999 год и резко увеличивалось с середины 2003 по 2009 год, параллельно с увеличением распространенности CVA4 в Китае.Тем не менее, согласно оценкам, численность популяции в 1999 г., середине 2003 г. и с 2009 по 2011 г. сократилась более существенно, чем в предыдущем отчете (Chen et al., 2018). Учитывая, что точность анализа демографической реконструкции чувствительна к выборке, определение резкого уменьшения размера популяции CVA4 в период с 1999 по середину 2003 года потребует дополнительных усилий по выборке. Следовательно, срочно необходим национальный надзор за различными энтеровирусами человека, вызывающими HFMD, для выяснения сложной эволюционной динамики и совместной циркуляции энтеровирусов, чтобы обеспечить доказательную базу для рациональных диагностических и профилактических подходов к снижению бремени болезней.

Средняя скорость эволюции гена CVA4 VP1 была оценена как 5,12 × 10 -3 замен / сайт / год, немного ниже, но примерно в том же диапазоне, что и 6,4 × 10 -3 замен / сайт / год, по оценке Чена. и другие. (2018). По нашим оценкам, общий предок известного CVA4 существовал приблизительно 75 лет назад, что также аналогично предыдущей оценке (71,8 года назад) (Tee et al., 2010). Интересно, что скорость эволюции EVA71 VP1 оценивается примерно в 4,6 × 10 -3 замен / сайт / год для обеих геногрупп B и C EVA71 (Tee et al., 2010; Chen et al., 2018). Скорость эволюции CVA6 оценивалась в 8,1 × 10 -3 замен / сайт / год (Puenpa et al., 2016), а CVA16 составляла 6,7 × 10 -3 замен / сайт / год (Zhao et al. ., 2016). Следовательно, CVA4, по-видимому, эволюционирует с той же скоростью, что и другие основные патогены HFMD, что заслуживает дальнейшего внимания.

Coxsackievirus A4 имеет общие фенотип-ассоциированные аминокислотные замены по сравнению с прототипным штаммом EVA71, BrCr.Особо следует отметить, что VP1 169F , идентифицированный в EVA71, может придавать способность связывания вируса с рецептором SCARB2 млекопитающих, также обнаруживаемым в изолятах CVA4 (Yamayoshi et al., 2012). Кроме того, у вирусов BrCr и CVA4 было несколько сайтов с разными аминокислотными мотивами. Однако следует отметить, что, хотя биологическая значимость этих сайтов со специфическими аминокислотными заменами была подтверждена в EVA71, они были идентифицированы путем сравнения последовательностей между CVA4 и EVA71. Следовательно, влияние этих критических аминокислот в CVA4 на связывание рецептора , вирусная инфекционность, адаптация млекопитающих к репликации и патогенез требуют дальнейших исследований.

Кроме того, мы также обнаружили потенциальные события генетической рекомбинации в геномах CVA4 (n = 31), используя программу обнаружения рекомбинации (RDP) v4.16 (Martin et al., 2015) и Simplot v3.5.1 (Hu et al., 2011). ). Однако нам не удалось обнаружить убедительные события рекомбинации в 21 недавно секвенированном вирусе CVA4 (данные не показаны). В целом, похоже, что генетическая замена, а не рекомбинация, сыграла более важную роль в эволюции и диверсификации CVA4, несмотря на то, что события рекомбинации часто идентифицируются в других энтеровирусах человека (Hu et al., 2011). Однако ограниченные данные эпиднадзора могли также привести к недооценке количества событий генетической рекомбинации в эволюции CVA4.

Таким образом, мы описали 21 новую последовательность генома CVA4, которая значительно обогащает доступные геномные данные для CVA4. Филогенетический анализ показал, что генотипы C, D1 и D2 совместно циркулировали в начале 2000-х годов, а теперь D2 вытеснил D1 и стал преобладающим субгенотипом в Китае. Генетическое разнообразие китайского CVA4 обнаруживается в областях, кодирующих неструктурные белки, и в третьей позиции колебания кодонов.Напротив, меньше мутаций произошло в области гена VP1, что делает ее оптимальной областью-кандидатом для разработки молекулярных анализов и потенциально в качестве консервативного эпитопа для вакцинации. Примечательно, что CVA4 может обладать более высокой аффинностью связывания с SCARB2 из-за замены L169F в белке VP1, и то, как эта замена влияет на вирусную инфекционность и клинические исходы, следует исследовать в будущем. В дополнение к мониторингу EVA71 и CVA16 в Китае срочно необходим усиленный надзор за все более распространенными, а также вирулентными агентами, включая CVA4, чтобы лучше понять динамику циркуляции и эволюции энтеровирусов человека, что предоставит бесценную информацию для диагностических и профилактических подходов к содержать болезнь.

Авторские взносы

MW, JL и W-FS разработали исследование, участвовали во всех тестах и ​​составили рукопись. M-XY, Y-WZ, S-JD и X-JW участвовали в сборе и тестировании образцов. TH, MC, SD, X-CZ, Z-JZ, HZ и Y-GT разработали исследование, внесли свой вклад в анализ результатов и подготовку исправленных версий рукописей. Все авторы прочитали и одобрили окончательную рукопись.

Финансирование

Работа поддержана Национальной программой исследований и разработок в области ключевых технологий Китая (проект №2017ZX10104001-006), Фонд естественных наук провинции Шаньдун (ZR2018PH034), Проекты развития медицины и здравоохранения провинции Шаньдун (2013WS0157 и 2017WS066), Муниципальная программа развития науки и технологий Тайань (2017NS0107) и Национальный фонд естественных наук Китая (81601773). W-FS был поддержан программой стипендиатов Тайшань провинции Шаньдун (ts201511056).

Заявление о конфликте интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.

Дополнительные материалы

Дополнительные материалы к этой статье можно найти в Интернете по адресу: https://www.frontiersin.org/articles/10.3389/fmicb.2019.01001/full#supplementary-material

Сноски

  1. http: /beast.bio.ed.ac.uk/Tracer
  2. http: /tree.bio.ed.ac.uk/software/figtree/
  3. www.picornaviridae.com

Список литературы

Арита, М., Симидзу, Х., Нагата, Н., Ами, Ю., Сузаки, Ю., Сата, Т., и другие. (2005). Чувствительные к температуре мутанты энтеровируса 71 демонстрируют ослабление у яванских макак. J. Gen. Virol. 86 (Pt 5), 1391–1401. DOI: 10.1099 / vir.0.80784-0

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Баэле, Г., Лемей, П., Бедфорд, Т., Рамбаут, А., Сушард, М. А., Алексеенко, А. В. (2012). Повышение точности сравнения моделей демографических и молекулярных часов с учетом филогенетической неопределенности. Мол. Биол. Evol. 29, 2157–2167. DOI: 10.1093 / молбев / mss084

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Цай, К., Яо, X., Чжо, Ф., Хэ, Ю. и Ян, Г. (2015). [Генная характеристика области VP1 вируса Коксаки A4 из случаев герпетической ангины в Шэньчжэне, Китай]. Чжунхуа И Сюэ За Чжи 95, 1226–1229.

PubMed Аннотация | Google Scholar

Каин, Э. А., Монкла, Л. Х., Рондерос, М. Д., Фридрих, Т. К., и Осорио, Дж. Э. (2016). Единственная мутация в VP1 энтеровируса 71 ответственна за повышенную вирулентность и нейротропизм у взрослых мышей с дефицитом интерферона.J. Virol. 90, 8592–8604. DOI: 10.1128 / JVI.01370-16

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Кэри Д. Э. и Майерс Р. М. (1969). Выделение вируса Коксаки типа A4 из сыворотки крови ребенка с быстро смертельным заболеванием с тяжелыми проявлениями центральной нервной системы. Indian J. Med. Res. 57, 765–769.

PubMed Аннотация | Google Scholar

Chen, P., Wang, H., Tao, Z., Xu, A., Lin, X., Zhou, N., et al. (2018). Множественные цепи передачи вируса Коксаки A4, одновременно циркулирующего в Китае и соседних странах в последние годы: филогенетический и пространственно-временной анализ на основе вирусологического надзора.Мол. Филогенет. Evol. 118, 23–31. DOI: 10.1016 / j.ympev.2017.09.014

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Chu, P. Y., Lu, P. L., Tsai, Y. L., Hsi, E., Yao, C. Y., Chen, Y. H., et al. (2011). Пространственно-временной филогенетический анализ и молекулярная характеристика вируса Коксаки A4. Заразить. Genet. Evol. 11, 1426–1435. DOI: 10.1016 / j.meegid.2011.05.010

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Чуа, Б. Х., Фуэктес, П., Сандерс, С. А., Николлс, П. К., и Макминн, П. К. (2008). Молекулярные основы адаптации мышей к энтеровирусу человека 71. J. Gen. Virol. 89 (Pt 7), 1622–1632. DOI: 10.1099 / vir.0.83676-0

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Cordey, S., Petty, T. J., Schibler, M., Martinez, Y., Gerlach, D., van Belle, S., et al. (2012). Идентификация сайт-специфических адаптаций, вызывающих повышенный тропизм нервных клеток во время инфицирования энтеровирусом человека 71. PLoS Pathog.8: e1002826. DOI: 10.1371 / journal.ppat.1002826

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Дальдорф, Г. (1953). Группа вирусов Коксаки. Аня. Акад. Sci. 56, 583–586. DOI: 10.1111 / j.1749-6632.1953.tb30251.x

CrossRef Полный текст | Google Scholar

Драммонд, А. Дж., Рамбо, А., Шапиро, Б., и Пибус, О. Г. (2005). Байесовский объединенный вывод прошлой динамики популяции на основе молекулярных последовательностей. Мол. Биол. Evol. 22, 1185–1192.DOI: 10.1093 / molbev / msi103

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Эстрада Гонсалес, Р., Мас, П. (1977). Вирусологические исследования при остром полирадикулоневрите ЛГБС-типа. Различные выводы в отношении вируса Коксаки A4. Neurol. Neurocir. Psiquiatr. 18 (2–3 доп.), 527–531.

PubMed Аннотация

Фариа, Н. Р., Квик, Дж., Кларо, И. М., Тезе, Дж., Де Хесус, Дж. Г., Джованетти, М. и др. (2017). Установление и загадочная передача вируса Зика в Бразилии и Америке.Nature 546, 406–410. DOI: 10.1038 / природа22401

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ху, Ю. Ф., Ян, Ф., Ду, Дж., Донг, Дж., Чжан, Т., Ву, З. К. и др. (2011). Полный анализ генома штаммов вируса Коксаки A2, A4, A5 и A10, выделенных у пациентов с заболеваниями рук, ног и рта в Китае, выявил частую рекомбинацию энтеровируса человека A. J. Clin. Microbiol. 49, 2426–2434. DOI: 10.1128 / JCM.00007-11

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Хуанг, С.В., Ван, Ю. Ф., Ю, К. К., Су, И. Дж., И Ван, Дж. Р. (2012). Мутации в капсидных белках VP2 и VP1 увеличивают инфекционность и летальность энтеровируса 71 для мышей за счет связывания вируса и увеличения накопления РНК. Вирусология 422, 132–143. DOI: 10.1016 / j.virol.2011.10.015

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Келли, Дж. Т., Де Колибус, Л., Эллиотт, Л., Фрай, Э. Э., Стюарт, Д. И., Роулендс, Д. Дж. И др. (2015). Сильные противовирусные агенты не вызывают генетически стабильных мутаций устойчивости ни в энтеровирусе 71, ни в вирусе Коксаки А16.Антивирь. Res. 124, 77–82. DOI: 10.1016 / j.antiviral.2015.10.006

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ноулз, Н. Дж., Хови, Т., Хюпия, Т., Кинг, А. М. К., Линдберг, А. М., Палланш, М. А., и др. (2012). «Picornaviridae» в «Таксономия вирусов: классификация и номенклатура вирусов: девятый доклад Международного комитета по таксономии вирусов», редакторы А. М. К. Кинг, М. Дж. Адамс, Э. Лефковиц и Э. Б. Карстенс (Сан-Диего, Калифорния: Эльзевьер).

Google Scholar

Ли, К.J., Huang, Y.C., Yang, S., Tsao, K.C., Chen, C.J., Hsieh, Y.C., et al. (2014). Клинические особенности инфекций, вызванных вирусом Коксаки A4, B3 и B4, у детей. PLoS One 9: e87391. DOI: 10.1371 / journal.pone.0087391

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Li, J. S., Dong, X. G., Qin, M., Xie, Z. P., Gao, H. C., Yang, J. Y., et al. (2015). Вспышка лихорадочного заболевания, вызванного вирусом Коксаки A4, в детском саду в Пекине, Китай. Virol. J. 12:92. DOI: 10.1186 / s12985-015-0325-1

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Лю Дж.Ф., Чжан Ю. и Ли Х. (2009). [Генетическая характеристика VP4-VP2 двух вирусов Коксаки A4, выделенных от пациентов с болезнью рук, ящура и рта]. Чжунго И Мяо Хэ Мянь И 15, 345–349.

PubMed Аннотация | Google Scholar

Лю Ю.С., Чжоу, Дж. Х., Чен, Х. Т., Ма, Л. Н., Пейсак, З., Дин, Ю. З. и др. (2011). Характеристики использования синонимичных кодонов в вирусе энтеровируса 71 и влияние хозяина на вирус в структуре использования кодонов. Заразить. Genet. Evol.11, 1168–1173. DOI: 10.1016 / j.meegid.2011.02.018

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ma, M. R., Hui, L., Wang, M. L., Tang, Y., Chang, Y. W., Jia, Q. H., et al. (2014). Общая картина использования кодонов энтеровируса 71. Genet. Мол. Res. 13, 336–343. DOI: 10.4238 / 2014. 21.1 января

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Мартин Д. П., Мюррелл Б., Голден М., Хосал А. и Мухир Б. (2015). RDP4: обнаружение и анализ паттернов рекомбинации в вирусных геномах.Virus Evol. 1: vev003. DOI: 10.1093 / ve / vev003

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Мельник, Дж. Л. (1950). Исследования вирусов Коксаки; свойства, иммунологические аспекты и распространение в природе. Бык. Акад. Med. 26, 342–356.

PubMed Аннотация | Google Scholar

Mine, I., Taguchi, M., Sakurai, Y., and Takeuchi, M. (2017). Двусторонний идиопатический васкулит сетчатки после инфицирования вирусом Коксаки A4: отчет о клиническом случае.BMC Ophthalmol. 17: 128. DOI: 10.1186 / s12886-017-0523-2

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Миямура, К., Нисимура, Ю., Або, М., Вакита, Т., и Симидзу, Х. (2011). Адаптивные мутации в геномах штамма энтеровируса 71 после инфицирования клеток мыши, экспрессирующих лиганд-1 гликопротеина Р-селектина человека. J. Gen. Virol. 92 (Pt 2), 287–291. DOI: 10.1099 / vir.0.022418-0

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Нисимура, Ю., Ли, Х., Хафенштейн, С., Катаока, К., Вакита, Т., Бергельсон, Дж. М. и др. (2013). Связывание энтеровируса 71 с PSGL-1 на лейкоцитах: VP1-145 действует как молекулярный переключатель, контролирующий взаимодействие рецепторов. PLoS Pathog. 9: e1003511. DOI: 10.1371 / journal.ppat.1003511

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Оберсте, М.С., Пенаранда, С., Махер, К., и Палланш, М.А. (2004). Полные последовательности генома всех представителей вида Энтеровирус человека A. J. Gen. Virol.85 (Pt 6), 1597–1607. DOI: 10.1099 / vir.0.79789-0

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Паласиос, Г., Касас, И., Тенорио, А., Фрейре, К. (2002). Молекулярная идентификация энтеровируса путем анализа частичной области генома VP1 различными методами. J. Clin. Microbiol. 40, 182–192. DOI: 10.1128 / jcm.40.1.182-192.2002

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Пуенпа, Дж., Вонгпунсавад, С., Остербак, Р., Варис, М., Эрикссон, Э., Альберт, Дж. И др. (2016). Молекулярная эпидемиология и эволюция вируса Коксаки человека A6. J. Gen. Virol. 97, 3225–3231. DOI: 10.1099 / jgv.0.000619

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Основная группа разработчиков

R (2012 г.). R: Язык и среда для статистических вычислений. Вена: Фонд R для статистических вычислений.

Google Scholar

Рамбаут А., Лам Т. Т., Макс Карвалью Л. и Пибус О. Г. (2016).Изучение временной структуры гетерохронных последовательностей с помощью TempEst (ранее Path-O-Gen). Virus Evol. 2: vew007. DOI: 10.1093 / ve / vew007

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Рамирес К., Грегори Дж., Бути М., Табернеро Д., Камос С., Касильяс Р. и др. (2013). Сравнительное исследование сверхглубокого пиросеквенирования и клонирования для количественного анализа квазивидов вируса с использованием инфекции вируса гепатита В в качестве модели. Антивирь. Res. 98, 273–283.DOI: 10.1016 / j.antiviral.2013.03.007

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Рико-Гессе, Р., Палланш, М. А., Ноттай, Б. К., и Кью, О. М. (1987). Географическое распространение генотипов дикого полиовируса типа 1. Вирология 160, 311–322. DOI: 10.1016 / 0042-6822 (87)

-8

CrossRef Полный текст | Google Scholar

Shih, S. R., Chiang, C., Chen, T. C., Wu, C. N., Hsu, J. T., Lee, J. C., et al. (2004a). Мутации в доменах KFRDI и VGK протеазы 3C энтеровируса 71 влияют на его РНК-связывающую и протеолитическую активность.J. Biomed. Sci. 11, 239–248. DOI: 10.1159 / 000076036

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ши, С. Р., Цай, М. К., Ценг, С. Н., Вон, К. Ф., Шиа, К. С., Ли, В. Т. и др. (2004b). Мутация в капсидном белке VP1 энтеровируса 71 придает устойчивость к ингибирующим эффектам пиридилимидазолидинона. Противомикробный. Агенты Chemother. 48, 3523–3529. DOI: 10.1128 / AAC.48.9.3523-3529.2004

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Стаматакис, А., Людвиг, Т., и Мейер, Х. (2005). RAxML-III: быстрая программа для вывода больших филогенетических деревьев на основе максимального правдоподобия. Биоинформатика 21, 456–463. DOI: 10.1093 / биоинформатика / bti191

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Su, W., Li, X., Chen, M., Dai, W., Sun, S., Wang, S., et al. (2017). Анализ использования синонимичных кодонов вирусов болезней рук, ящура: сравнительное исследование вирусов Коксаки A6, A10, A16 и энтеровируса 71 с 2008 по 2015 гг.Заразить. Genet. Evol. 53, 212–217. DOI: 10.1016 / j.meegid.2017.06.004

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Тамура, К., Петерсон, Д., Петерсон, Н., Стечер, Г., Ней, М., и Кумар, С. (2011). MEGA5: анализ молекулярной эволюционной генетики с использованием методов максимального правдоподобия, эволюционного расстояния и максимальной экономии. Мол. Биол. Evol. 28, 2731–2739. DOI: 10.1093 / molbev / msr121

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Тройник, К.К., Лам, Т. Т., Чан, Ю. Ф., Библия, Дж. М., Камарулзаман, А., Тонг, К. Ю. и др. (2010). Эволюционная генетика энтеровируса человека 71: происхождение, популяционная динамика, естественный отбор и сезонная периодичность гена VP1. J. Virol. 84, 3339–3350. DOI: 10.1128 / JVI.01019-09

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Целигка Э. Д., Собо К., Стоппини Л., Каньо В., Абдул Ф., Пиуз И. и др. (2018). Мутация VP1, приобретенная во время диссеминированной инфекции энтеровируса 71, придает способность связывать гепарансульфат и модулирует тропизм ex vivo.PLoS Pathog. 14: e1007190. DOI: 10.1371 / journal.ppat.1007190

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Уэда Ю., Кензака Т., Нода А., Ямамото Ю. и Мацумура М. (2015). Болезнь Кавасаки у взрослых (синдром кожно-слизистых лимфатических узлов) и сопутствующая инфекция, вызванная вирусом Коксаки A4: отчет о болезни. Int. Med. Case Rep. J. 8, 225–230. DOI: 10.2147 / IMCRJ.S

  • PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Викторио, К. Б., Сюй, Ю., Нг, К., Мэн, Т., Чоу, В. Т., и Чуа, К. Б. (2016). Кооперативный эффект аминокислот 98E, 145A и 169F VP1 в продуктивной инфекции линий мышиных клеток энтеровирусом 71 (штамм BS). Emerg. Микробы заражают. 5: e60. DOI: 10.1038 / emi.2016.56

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Wang, D., Xu, Y., Zhang, Y., Zhu, S., Si, Y., Yan, D., et al. (2016). [Генетические характеристики вируса Коксаки группы А типа 4, выделенного от пациентов с острым вялым параличом в Шэньси, Китай].Бин Ду Сюэ Бао 32, 145–149.

    PubMed Аннотация | Google Scholar

    Wang, J., Hu, T., Sun, D., Ding, S., Carr, M.J., Xing, W., et al. (2017). Эпидемиологические характеристики болезней рук, ног и рта в Шаньдуне, Китай, 2009-2016 гг. Sci. Реп. 7: 8900. doi: 10.1038 / s41598-017-y, мы выполнили байесовский sk09196-z

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ямаёси, С., Иидзука, С., Ямасита, Т., Минагава, Х., Мизута, К., Окамото, М., и другие. (2012). SCARB2-зависимая инфекция человека, вызванная вирусом Коксаки А7, А14 и А16 и энтеровирусом 71. J. Virol. 86, 5686–5696. DOI: 10.1128 / JVI.00020-12

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Зайни, З., Макминн, П. (2012). Одиночная мутация в капсидном протеине VP1 (Q145E) штамма геногруппы C4 энтеровируса человека 71 генерирует вирулентный фенотип мыши. J. Gen. Virol. 93 (Pt 9), 1935–1940. DOI: 10.1099 / vir.0.043893-0

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Заини, З., Фуэктес, П., и Макминн, П. (2012). Мышиная адаптация штамма подгеногруппы B5 энтеровируса 71 человека связана с заменой нового лизина на глутаминовую кислоту в положении 244 в белке VP1. Virus Res. 167, 86–96. DOI: 10.1016 / j.virusres.2012.04.009

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Zhang, H., Cao, H. W., Li, F. Q., Pan, Z. Y., Wu, Z. J., Wang, Y. H., et al. (2014). Анализ использования синонимичных кодонов в энтеровирусе 71. Вирусная болезнь 25, 243–248.DOI: 10.1007 / s13337-014-0215-y

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Zhang, Z., Dong, Z., Li, J., Carr, M.J., Zhuang, D., Wang, J., et al. (2017a). Защитная эффективность инактивированной формальдегидом цельновирусной вакцины и противовирусных препаратов на мышиной модели инфекции Коксаки вируса a10. J. Virol. 91: e00333-17. DOI: 10.1128 / JVI.00333-17

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Чжан, З., Донг, З., Вэй, К., Карр, М.J., Li, J., Ding, S., et al. (2017b). Модель инфекции Коксаки вируса А6 на неонатальных мышах для оценки противовирусной эффективности и эффективности вакцины. J. Virol. 91: e02450-16. DOI: 10.1128 / JVI.02450-16

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Чжао, Г., Чжан, X., Ван, К., Ван, Г., и Ли, Ф. (2016). Характеристика последовательности VP1 изолятов вируса Коксаки А16 байесовским эволюционным методом. Virol. J. 13: 130. DOI: 10.1186 / s12985-016-0578-3

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Чжэнь Р., Zhang, Y., Xie, H., Chen, C., Geng, J., He, P., et al. (2014). [Анализ последовательности VP1-области вируса Коксаки A4 и вируса Коксаки A10 в городе Гуанчжоу, 2010-2012 гг.]. Чжунхуа Ю Фан И Сюэ За Чжи 48, 445–450.

    PubMed Аннотация | Google Scholar

    Доктор Джефф Херш: Инфекция распространяется группами — Новости — Braintree Forum

    Вопрос: В детском саду моей дочери произошла вспышка болезни рук, ящура и рта. Откуда это?

    Вопрос: В детском саду моей дочери произошла вспышка болезни рук, ящура и рта.Откуда это?

    A: Болезни рук, ящура и рта чаще всего возникают в результате заражения вирусом Коксаки. Вирусы Коксаки названы в честь города Коксаки, штат Нью-Йорк, где они были впервые выделены доктором Дальдорфом в 1948 году, когда он искал лекарство от полиомиелита. Вирусы Коксаки — это тип вируса, который живет в пищеварительном тракте (энтеровирусы) и принадлежит к тому же семейству, что и вирус гепатита А и вирус полиомиелита. Есть две разные группы вируса Коксаки и разные серотипы внутри каждой группы.

    Энтеровирусы довольно заразны и обычно передаются фекально-оральным путем; несоответствующая гигиена и / или мытье рук инфицированным человеком позволяет ему передать вирус другому человеку.

    Вирусы Коксаки также могут передаваться через респираторные выделения (при чихании или кашле) и даже через жидкость из кожных волдырей. После заражения вирус инкубируется в течение нескольких дней, размножаясь в дыхательных путях или тонком кишечнике (в зависимости от способа передачи).

    Заражение вирусом Коксаки очень распространено. Ежегодно в США регистрируется более 10 миллионов случаев заражения энтеровирусами, и до четверти из них вызваны вирусом Коксаки. Фактически, до 80 процентов взрослых имеют антитела как минимум к одному типу энтеровирусов, что свидетельствует о наличии у них в прошлом инфекции. Вирус Коксаки чаще всего встречается у детей в возрасте до 5 лет, хотя дети старшего возраста и взрослые также заражаются им.

    Около 90 процентов инфекций, вызванных вирусом Коксаки, либо не вызывают никаких симптомов, либо вызывают только неспецифические гриппоподобные симптомы, такие как лихорадка, недомогание, ломота в теле и / или боль в горле.Однако в остальных 10% случаев другие заболевания возникают в результате заражения вирусом Коксаки.

    Вирусы Коксаки группы B могут поражать сердце, мышцы, плевру (мешок вокруг легких), поджелудочную железу и / или печень, вызывая миокардит (воспаление сердца), перикардит (воспаление мешка вокруг сердца), плевродинию. (боль в груди или животе от воспаления там мышц) или гепатит (воспаление печени).

    Вирусы Коксаки группы А обычно поражают кожу и / или слизистые оболочки.Они могут вызывать герпангину (с симптомами лихорадки и сыпи / язв в горле), геморрагический конъюнктивит (воспаление конъюнктивы, прозрачной оболочки, покрывающей глаз) и болезни рук, ног и рта.

    Болезнь рук, ящура и рта не следует путать с болезнью копыт и рта, которая поражает раздвоенных лап, таких как коровы, овцы и свиньи, и представляет собой совершенно другую инфекцию, не поражающую людей.

    Симптомы болезни рук, ящура и рта сначала начинаются с лихорадки и симптомов, похожих на грипп.В течение нескольких дней красные пятна во рту превращаются в язвы, обычно поражающие десны, внутреннюю поверхность щек и / или язык, а также в не зудящую красную сыпь (которая может быть плоской или приподнятой) на руках. и / или ноги. Не у всех, страдающих болезнью рук, ног и рта, есть все симптомы. Симптомы обычно длятся несколько дней и проходят самостоятельно.

    Диагноз болезней рук, ящура и рта ставится на основании анамнеза и медицинского осмотра; дальнейшее тестирование обычно не требуется.Лечение направлено на минимизацию симптомов (например, ацетаминофен при лихорадке) и введение жидкости для предотвращения обезвоживания (боль во рту может уменьшить пероральное потребление).

    В редких случаях вирус Коксаки может вызывать тяжелые заболевания, в том числе уже отмеченные выше, в результате инфекции группы B. Кроме того, менингит (воспаление слизистой оболочки головного и спинного мозга) и энцефалит (воспаление головного мозга) могут осложнять заражение вирусами группы A или группы B. Эти более серьезные инфекции обычно лечатся в больнице с поддерживающей терапией (нет специальных лекарств для лечения инфекции, вызванной вирусом Коксаки), хотя есть некоторые сообщения о том, что миокардит (и, возможно, другие тяжелые случаи) могут выиграть от внутривенной терапии иммуноглобулинами.

    Верификация диагноза более тяжелых инфекций обычно проводится с помощью лабораторного анализа (выделение вируса в клеточных культурах или ПЦР-тест) жидкостей пациента (таких как мазок из горла, образец кала или даже жидкость из волдырей) .

    Не существует вакцины для предотвращения заражения вирусом Коксаки. Поскольку инфекция вирусом Коксаки чаще встречается у детей, важно не допускать заразных детей в детский сад / школу, поощрять тщательное мытье рук и дезинфицировать поверхности, к которым часто прикасаются.

    Хотя инфекция серотипом вируса Коксаки дает пожизненный иммунитет, это иммунитет только к этому конкретному серотипу; поэтому еще возможно заразиться от других серотипов.

    Джефф Херш, доктор философии, доктор медицины, F.A.A.P., F.A.C.P., F.A.A.E.P., можно связаться по адресу [email protected]

    Болезни рук, ящура

    Требование об уведомлении о заболеваниях рук, ящура и рта

    Уведомление не требуется.

    Исключение из начальной школы и детских центров по лечению заболеваний рук, ящура и рта

    Исключение начальной школы и детских центров необходимо до тех пор, пока не высохнут все волдыри.

    Возбудитель болезней рук, ящура и рта

    Основными агентами, вызывающими болезнь рук, ящура и рта (HFMD), являются энтеровирусы человека вида A, особенно вирус Коксаки A16 (CA16) и энтеровирус 71 (EV71). Они принадлежат к роду Enterovirus в семействе Picornaviridae.

    Вирус Коксаки A6 и вирус Коксаки A10 также связаны с HFMD и герпангиной (острое лихорадочное заболевание, связанное с небольшими везикулярными или язвенными поражениями на задних структурах ротоглотки).

    Болезнь рук, ящура и рта человека не связана с ящуром животных (вызывается представителями рода Aphthovirus).

    Выявление болезней рук, ящура и рта

    Клинические признаки

    HFMD встречается в основном у детей младше 5 лет. Иногда это может произойти у взрослых. Симптомы и поражения обычно сохраняются в течение 7–10 дней.

    Клиническая картина состоит из лихорадки и везикулярных поражений на щечных поверхностях щек, десен и боковых сторон языка, начиная с небольших красных пятен, которые покрываются волдырями и часто переходят в язвы.

    Папуловезикулярные поражения ладоней, пальцев и подошв обычно возникают в течение 1-2 дней. Иногда макулопапулезные поражения появляются на коленях, локтях, ягодицах и в области гениталий.

    У некоторых людей, особенно маленьких детей, может развиться обезвоживание, если они не могут проглотить достаточное количество жидкости из-за болезненных язв во рту.

    Осложнения включают вирусный (асептический) менингит с головной болью, ригидностью шеи и чувствительностью к свету, но это случается редко.

    Воспаление мозга (энцефалит), паралич или отек легких (жидкость в легких) могут возникать, но также очень редко.

    Сообщалось о потере ногтей на руках и ногах, но это временное явление, и ногти отрастают без лечения.

    Диагностика

    Диагноз HFMD обычно ставится на основании клинических данных.

    В зависимости от степени тяжести симптомов наиболее полезными образцами для подтверждения диагноза HFMD являются образцы из глотки, пузырьков или стула.

    Полимеразная цепная реакция (ПЦР) может использоваться для подтверждения диагноза.

    Инкубационный период вирусов болезней рук, ящура

    Инкубационный период 3–7 дней.

    Значение для общественного здравоохранения и частота заболеваний рук, ящура и рта

    HFMD встречается во всем мире спорадически и в виде эпидемий. Наибольшая заболеваемость отмечается летом и ранней осенью. В тропических и субтропических странах циркуляция вируса, как правило, происходит круглый год, с увеличением числа вспышек в сезон дождей.Вспышки часто происходят среди групп детей в детских учреждениях и школах.

    Резервуар вирусов болезней рук, ящура и рта

    Люди — это резервуар.

    Пути передачи вирусов болезней рук, ящура и рта

    HFMD передается при прямом контакте с жидкостью из везикулярных поражений, прямом контакте с выделениями из носа и горла и фекалиями инфицированного человека, распространением аэрозольных капель и загрязненными фомитами (предметами и поверхностями).

    Период инфекционной болезни рук, ящура

    HFMD передается во время острой стадии заболевания через выделения из носа и горла до тех пор, пока в очагах остается жидкость. Вирусы сохраняются в стуле несколько недель.

    Восприимчивость и устойчивость к болезням рук, ящура и рта

    Заразению подвержены все. Иммунитет к конкретному вирусу может быть приобретен в результате перенесенной инфекции.Второй приступ может произойти с вирусом Коксаки группы А другого серотипа.

    Меры борьбы с болезнями рук, ящура и рта

    Предупредительные меры

    Вакцины для защиты от HFMD не существует.

    Контроль дела

    Управление делом включает:

    • исключение из школы детей с HFMD до полного высыхания волдырей
    • по возможности закрывает раны на руках и ногах и дает им высохнуть естественным путем
    • избегайте колющих поражений, так как жидкость внутри волдырей заразна
    • надлежащее мытье рук, очистка и удаление загрязненных предметов
    • избегание близких контактов, таких как поцелуи, объятия или совместное использование посуды и питья с другими.

    Контроль контактов

    Непригодный.

    Меры при вспышках болезней рук, ящура и рта

    Отдельные случаи и вспышки HFMD происходят по всему миру.

    С 1997 г. в Восточной и Юго-Восточной Азии регистрировались крупные вспышки HFMD, вызванные энтеровирусом 71, в основном у детей.

    В этих вспышках у большинства детей наблюдались типичные симптомы. Однако у небольшого числа пациентов развились тяжелые осложнения, потребовавшие госпитализации или даже приведшие к смерти.

    Введение — HSE.ie

    Болезнь рук, ящура и рта — обычно легкое заболевание, которое проходит само по себе. Осложнения случаются редко, но могут включать следующее.

    Обезвоживание

    Язвы, образующиеся в горле и во рту, могут затруднить пить и глотать. В результате может произойти обезвоживание. Поэтому при заболевании важно пить много жидкости. Если ваш ребенок болен, убедитесь, что он много пьет.

    Если обезвоживание становится серьезным, вам, возможно, придется пойти в больницу, чтобы капельницу в руку (внутривенно) ввести жидкость.

    Инфекция

    Еще одно возможное осложнение при заболеваниях рук, ягодиц и язв — инфицирование язв. Если язвочки почесать, они могут инфицироваться. В этом случае ваш терапевт может назначить антибиотики для лечения инфекции.

    Вирусный менингит

    В редких случаях болезнь рук, ящура и рта может привести к вирусному менингиту.Вирусный менингит — это инфекция мозговых оболочек (оболочек, покрывающих головной и спинной мозг).

    Вирусный менингит менее серьезен, чем бактериальный менингит, и большинство людей полностью выздоравливает в течение двух недель. Симптомы включают жар, сонливость, головную боль, ригидность шеи, рвоту и неприязнь к яркому свету. Специфического лечения нет.

    Энцефалит

    В очень редких случаях болезнь рук, ящура и рта может привести к энцефалиту.Энцефалит — это инфекция, при которой ткань мозга опухает и воспаляется. Это может вызвать повреждение мозга и потенциально опасно для жизни.

    Ранними признаками энцефалита являются симптомы гриппа, которые могут развиться в течение нескольких часов или нескольких дней. Другие симптомы включают:

    • рвота,
    • сонливость или замешательство,
    • изъятий (припадков) и
    • изъятий

    • нелюбовь к яркому свету.

    Если у вас разовьется энцефалит, вам нужно будет госпитализировать. Многие люди полностью выздоравливают.

    Во время вспышки ящура рук и рта на севере Вьетнама в 2015–2016 гг. Недавно возникший энтеровирус-A71 подлиния C4 может быть более вирулентным, чем B5.

    Объекты и определение степени заболевания

    С 1 января 2015 г. по 31 декабря 2016 г. все Дети с диагнозом HFMD из Вьетнамской национальной педиатрической больницы, Ханой (NHP), были приглашены для участия в этом исследовании.Из 1047 детей с диагнозом HFMD 519 детей и их родители или законные опекуны дали свое информированное согласие на участие в этом исследовании. Из исследования был исключен 31 ребенок с хроническими, врожденными и ранее существовавшими заболеваниями. Таким образом, в это исследование были включены 488 детей с диагнозом HFMD (мужчины / женщины: 331/157, средний возраст: 17 месяцев [диапазон: 2–88]).

    Согласно Вьетнамским рекомендациям по диагностике и лечению HFMD 2012 г., клиническая тяжесть подразделяется на четыре степени: 38 .1 степень — наличие только герпангины и / или кожной сыпи; 2 степень — наличие миоклонического толчка; 3 степень — наличие вегетативной дисфункции с трудноизлечимым жаром и симптомами шока на ранних стадиях; и степень 4 — наличие сердечно-легочного коллапса. Пациенты с 1 степенью наблюдались дома; лица со 2-й степенью и выше были госпитализированы.

    Сбор, обнаружение и генотипирование энтеровирусов

    Мазки из горла и ректальные мазки были собраны у пациентов с диагнозом HFMD в 2015 и 2016 годах с помощью ватных наконечников, смоченных в физиологическом растворе с фосфатным буфером (PBS).Тампоны промывали 1 мл PBS и хранили при -80 ° C до использования.

    Образцы были генотипированы путем анализа последовательности гена VP1. Вкратце, образцы центрифугировали при 14000 об / мин в течение 15 минут. РНК экстрагировали из 140 мкл супернатантов ректальных мазков с помощью мини-набора для вирусной РНК QIAamp (QIAGEN GmbH, Германия) и из 100 мкл супернатантов мазков из горла с помощью набора SMITEST EX-R&D (Medical & Biological Laboratories Co. Ltd, Нагоя, Япония). ) в соответствии с инструкциями производителя. Частичный ген VP1 EV амплифицировали в анализе RT-snPCR с консенсусно-вырожденными гибридными олигонуклеотидными праймерами (CODEHOP) 39 .Продукты ПЦР секвенировали с использованием набора для секвенирования цикла BigDye Terminator v.1.1 Ready (Thermo Fisher Scientific, Техас, США). Для классификации вирусов и генотипирования BLAST использовался для поиска в справочной базе данных Национального центра биотехнологической информации (NCBI). Образцы ректальных мазков использовались для анализа только в том случае, если частичный ген VP1 EVs не был обнаружен в мазках из горла.

    Выделение вируса

    Аминокислотные остатки VP1–145 всех штаммов EV-A71, обнаруженные в клинических образцах, представляли собой глутаминовую кислоту (данные не показаны).Этот аминокислотный остаток быстро превратился в глицин или глутамин, и мутировавшие вирусы были ослаблены, когда вирусы размножались в клетках RD-A, которые экспрессируют гепарансульфат на поверхности клетки. Чтобы свести к минимуму эту мутацию и ослабление, мы использовали клетки RDΔEXT1 + hSCARB2, которые представляют собой клетки рабдомиосаркомы, лишенные экспрессии гепарансульфата, путем нокаута гена EXT1 и введения кДНК SCARB2 человека посредством ретровирусного переноса гена 40 для выделения и подготовки вируса.Клетки RDΔEXT1 + hSCARB2 поддерживали в среде Игла, модифицированной Дульбекко (DMEM; Вако, Осака, Япония), с добавлением 5% фетальной телячьей сыворотки (FBS; JRH Biosciences, KS, США), содержащей 1 мкг / мл пуромицина. Клетки RDΔEXT1 + hSCARB2 инокулировали отфильтрованными супернатантами мазков, положительных по РНК EV-A71, инкубировали в течение 1 ч при 37 ° C и культивировали в DMEM с добавлением 2% FBS без пуромицина. Клетки и культуральную среду собирали при появлении цитопатических эффектов. Вирус выделяли, подвергая клетки трем циклам замораживания-оттаивания, затем центрифугировали при 14000 об / мин в течение 15 минут.Супернатанты собирали, разделяли на аликвоты и хранили при -80 ° C до использования.

    Полное секвенирование гена VP1

    Вирусную РНК экстрагировали из выделенных вирусов с помощью мини-набора вирусной РНК QIAamp (Qiagen GmbH, Германия). ОТ-ПЦР выполняли в системе Access RT-PCR (Promega Co., Мэдисон, Висконсин, США). Реакции проводили с использованием 2 мкл каждой вирусной РНК и 50 пмоль пары праймеров: 2349 F (5′-GCYTAYATAATAGCAYTGGCGGCAGC-3 ‘) и 3393 R (5′-CACCCGTTGAADTCYCACCARTTGGCG-3′). Каждую реакцию проводили по следующему протоколу: 48 ° C в течение 45 мин; 94 ° С в течение 2 мин; 35 циклов 94 ° C в течение 10 с, 50 ​​° C в течение 10 с и 65 ° C в течение 1 мин; а затем 65 ° C в течение 5 мин.Ампликоны секвенировали напрямую с использованием праймеров 2757 F (5’-GCHAAYTGGGAYATAGACATAAC-3 ‘) и 3046 R (5′-CCAAAATRCTGCCYATRGG-3’). Последовательности анализировали с использованием ABI 3730 (Applied Biosystems).

    Филогенетический анализ

    Филогенетическое дерево было построено с использованием метода объединения соседей в программе молекулярно-эволюционного генетического анализа, версия 6.0 (MEGA 6.0). Восстановленное дерево эволюции было проверено загрузкой с 1000 повторений. Подгенотипы EV-A71 A, B и C и другие последовательности EV, полученные из Genbank, были использованы в качестве ссылок.

    Анализ секвенирования всего генома

    Библиотеки NGS были получены из вирусных РНК с использованием набора NEBNext RNA Library Prep Kit для Illumina (NEB) и NEBNext Multiplex Oligos для набора праймеров 1 двойного индекса Illumina (NEB) в соответствии с инструкциями производителя, с средняя длина фрагмента 300 п.н. Библиотеки секвенировали на MiSeq (Illumina) с использованием набора с парными концами 150 п.н.

    Адаптер и низкокачественные последовательности были вырезаны из считанных необработанных последовательностей с использованием программного обеспечения PRINSEQ версии 0.20.4 (http://prinseq.sourceforge.net/index.html). Для удаления считываний, полученных из клеток-хозяев, оставшиеся считывания были сопоставлены с эталонным геномом человека hg38 с использованием программного обеспечения Bowtie 2 версии 2.3.4.1 с настройками по умолчанию 41 . Консенсусная вирусная геномная последовательность была собрана из неотмеченных считываний hg38 с использованием программы de novo ассемблера IVA версии 1.0.8 с настройками по умолчанию 42 .

    Для определения распространенности мутации VP1–145 некартированные считывания hg38 были картированы в собранную консенсусную последовательность с использованием программного обеспечения Smalt версии 0.7.6 (https://www.sanger.ac.uk/science/tools/smalt-0) и преобразовал в файлы BAM с помощью программного обеспечения Samtools версии 1.9–4-gaelf9d8. Сгенерированные файлы BAM использовались для вызова вариантов с использованием программного обеспечения Lofreq версии 2.1.2 43 . Однонуклеотидные варианты (SNV) аннотировали с использованием программного обеспечения SnpEff версии 4.3t 44 . Чтобы гарантировать точность данных SNV, SNV, которые соответствовали следующим критериям, были отброшены: коэффициент численности был менее 10 −3 , а охват в позиции был меньше, чем log (1 — p) / log (1 — f). — 1, где частота мутации f была обнаружена с вероятностью p или лучше 45 .В этом исследовании p был установлен на 0,95. Количество считываний, сопоставленных с консенсусной вирусной последовательностью, и средняя глубина показаны в дополнительной таблице S1.

    Филогенетические деревья были построены на основе полного генома и каждого из 5’UTR, P1, P2, P3 и 3D регионов с использованием метода объединения соседей. Для обнаружения возможных событий рекомбинации были проведены анализы графика сходства и загрузочного сканирования. Четкое пересечение двух профилей запросов и ссылок с резкими наклонами считалось заменой наиболее подходящей ссылки и наличия ближайшей точки разрыва рекомбинации.

    Заражение вирусом у мышей hSCARB2-tg

    Мы случайным образом отобрали 25 штаммов EV-A71, выделенных от B5-инфицированных пациентов с HFMD клинической степени 1 и 2, включая оба штамма от пациентов со степенью 4. Однако мы исключили некоторые из них. штаммы вируса, которые не росли до высокого титра, подходящие для инокуляции мышей hSCARB2-tg. Мы также исключили четыре штамма вируса, содержащие мутацию VP1–145 более чем на 0,1% по оценкам NGS-анализа (дополнительная таблица S1), поскольку эта мутация была выбрана во время размножения EV-A71 в культивируемых клетках и серьезно снизила вирулентность EV-A71. (Кобаяши и др., представлен к публикации). В итоге мы отобрали 19 штаммов EV-A71 B5: 10 штаммов, выделенных от пациентов с 1-й степенью, 8 — от пациентов со 2-й степенью и 1 — от пациента с 4-й степенью тяжести. пациенты с 1 и 2 степенью соответственно. Эти 19 штаммов B5 и 8 штаммов C4 были инокулированы мышам hSCARB2-tg. Мы использовали 6- или 7-недельных мышей hSCARB2-tg 23 для экспериментов по заражению (n = 10 на группу). После анестезии путем ингаляции изофлурана внутрибрюшинно засевали всего 500 мкл раствора вируса (5 × 10 5 TCID 50 ) и PBS в качестве имитационного контроля.За инфицированными и ложно инфицированными мышами ежедневно наблюдали паралич (слабость конечностей с подергиванием или полный вялый паралич) и смерть в течение 14 дней. Мышей с вялым параличом более чем двух конечностей, умирающими и / или потерявшими более 30% массы тела умерщвляли передозировкой изофлурана или смещением шейного отдела матки.

    Заявление об этике

    Этот протокол исследования был рассмотрен и одобрен Комитетом по этике биомедицинских исследований Национальной больницы педиатрии и научно-исследовательского института детского здоровья, Вьетнам (номер разрешения [№] 14–012) и проводились в соответствии с Вьетнамскими национальными этическими руководящими принципами для биомедицинских исследований с участием людей, 2013 г., учрежденными Министерством здравоохранения Вьетнама. Письменное информированное согласие на использование их клинических образцов было получено от родителей или законных опекунов больных детей, образцы которых были проанализированы. Этот протокол исследования был также одобрен комитетами по этике Канадзавского университета, Япония (разрешение № 1611–1) и Токийского столичного института медицинских наук, Япония (разрешение №14–34) на основе Этических руководящих принципов для медицинских исследований с участием людей в качестве субъектов, установленных Министерством образования, культуры, спорта, науки и технологий и Министерством здравоохранения, труда и социального обеспечения Японии в 2014 г. (пересмотрено в 2017 г.) ).

    Эксперименты на животных проводились в соответствии с Руководством по уходу и использованию животных (Токийский столичный институт медицинских наук, 2011 г.), которые следуют Основным руководящим принципам надлежащего проведения экспериментов на животных и связанной с ними деятельности в академических исследовательских учреждениях, установка Министерством образования, культуры, спорта, науки и технологий Японии в 2006 году.Протокол экспериментов на животных был одобрен Комитетом по использованию и уходу за животными при Токийском столичном институте медицинских наук, Япония (разрешение № 18047).

    Статистический анализ

    Статистический анализ проводился с использованием SPSS версии 22. Для анализа различий в пропорциях категориальных переменных использовался критерий хи-квадрат. U-критерий Манна-Уитни использовался для проверки различий в медианах непрерывных переменных. Значения P <0,05 считались значимыми.

    Регистрационный номер нуклеотидной последовательности

    Полные последовательности VP1 112 штаммов EV-A71, описанных здесь, зарегистрированы в Genbank под номерами доступа MH557097 – MH557208.

    Заявление об ограничении ответственности

    Выводы и заключения этого отчета принадлежат авторам и не обязательно представляют Канадзавский университет, Токийский столичный институт медицинских наук, Вьетнамскую национальную педиатрическую больницу или Ханойский медицинский университет.

    10 фактов о заболеваниях рук, стопы и рта

    Главная »Темы» Информационный центр управления практикой

    Иногда бейсболисты выбывают из игры по необычным причинам.В 1994 году Стив Спаркс разделил плечо, пытаясь разорвать пополам телефонную книгу. 1 В 2002 году Марти Кордова заснул в солярии, и его лицо было так сильно обожжено, что врачи посоветовали ему держаться подальше от солнца. 2 В 2006 году Джоэл Сумайя напряг запястье, играя на Guitar Hero. 3 И совсем недавно питчер New York Mets Ноа Синдергаард попал в список инвалидов с болезнью рук, ног и рта. 4

    Вот 10 вещей, которыми вы, возможно, захотите поделиться со своими пациентами о недуге, который оттеснил звезду Mets 5-7 :

    1. Это легкая вирусная инфекция, характеризующаяся язвами во рту и сыпью на руках и ногах.
    2. Чаще всего вызывается вирусом Коксаки А16, вирусом, принадлежащим к семейству энтеровирусов.
    3. Чаще всего он передается через контакт со слюной инфицированного человека, выделениями из горла, стулом, волдырями или выделениями из носа. Он также может передаваться при контакте с загрязненными предметами, такими как дверные ручки, игрушки и ручки унитаза.
    4. Обычно симптомы появляются в течение 3–6 дней. Первым симптомом обычно является повышение температуры тела, за которым следует боль в горле и отсутствие аппетита.Затем появляются болезненные язвы во рту, за которыми следует сыпь на руках и ногах.
    5. Иногда симптомы отсутствуют, поэтому вы можете заразиться, не осознавая этого.
    6. Это наиболее часто встречается у младенцев и детей в возрасте до 5 лет. Тем не менее, болезнь рук, ног и рта у взрослых не является чем-то необычным. (Считается, что Синдергаард заразился этим вирусом во время проведения детского бейсбольного лагеря.)
    7. Обезвоживание — наиболее частое осложнение, поскольку язвы во рту и горле затрудняют глотание жидкости и делают ее болезненной.
    8. Специального лечения не существует; тем не менее, лечение может быть рекомендовано для снятия лихорадки и боли.
    9. Восстановление обычно занимает от 7 до 10 дней, но вирус может оставаться в организме в течение нескольких недель после исчезновения симптомов.
    10. Риск заражения можно снизить путем тщательного мытья рук и дезинфекции мест общего пользования. Поскольку вирус очень заразен, те, у кого он есть, должны ограничить свое воздействие на других.

    Хорошая новость заключается в том, что заболевание рук, ног и рта обычно является незначительным заболеванием, не требующим лечения.Итак, Syndergaard должен скоро вернуться в форму.


    Продолжить чтение

    Список литературы

    1. Одрикур Т. Бывший пивовар Спаркс знает, что инцидент с телефонной книгой является частью своего наследия. Милуоки Журнал Страж. 17 июня 2013 г. По состоянию на 27 июля 2018 г.
    2. Кристенсен Дж. Кордова сгорел. Балтиморское солнце. 23 мая 2002 г. По состоянию на 27 июля 2018 г.
    3. Орланд К. Герой гитары скамейки в высшей лиге. Engadget. 14 декабря 2006 г. По состоянию на 27 июля 2018 г.
    4. Axson S.Метс ставит Ноя Синдергаарда на DL с болезнью рук, ящура и рта. Sports Illustrated. 22 июля 2018 г. По состоянию на 27 июля 2018 г.
    5. Ящура рук. Клиника Майо. 26 июля 2017 г. По состоянию на 27 июля 2018 г.
    6. Болезни рук, ног и рта. Центры по контролю и профилактике заболеваний. Обновлено 28 июня 2018 г. Проверено 27 июля 2018 г.
    7. Что такое инфекции, вызванные вирусом Коксаки? KidsHealth. Отзыв написан в сентябре 2017 г. Получен 27 июля 2018 г.

    Темы:

    Управление практикой

    Хотите узнать больше?

    Пожалуйста, войдите или зарегистрируйтесь для просмотра этого контента.

    Авторизоваться
    регистр

    Открыть

    Следующее сообщение в Информационном центре управления практикой

    Закрывать

    Справочник для родителей по болезням рук, ящура

    Автор: @ellieloomes

    Об авторе: Софи — врач общей практики, ранее работавшая с Night Doctor, а теперь проживающая на юго-западе штата Вашингтон. Она интересуется здоровьем женщин и детей и прошла дополнительную подготовку по акушерству и гинекологии, сексуальному здоровью и хирургии рака кожи.Помимо своей клинической работы, она также преподает студентам-медикам в Университете Нотр-Дам, ранее была кооптированным членом профессорско-преподавательского совета RACGP WA, а в настоящее время является делегатом программы будущих лидеров RACGP.

    Что такое болезнь рук, ног и рта?

    Болезнь рук, ягодиц и рта (HFMD) — распространенное заболевание, вызываемое вирусами из группы энтеровирусов, в основном штаммом, называемым вирусом Коксаки. Обычно он вызывает легкое заболевание с характерным симптомом волдырей на руках, ногах и во рту — отсюда и название. 1,2,3,4,5,6

    Заболевание обычно начинается с неспецифических симптомов, таких как лихорадка, насморк и боль в горле. 1,5 Через день или два после появления этих симптомов на губах, языке и во рту начинают появляться волдыри, за которыми вскоре появляются волдыри на других участках тела. Чаще всего поражаются руки и ноги, но волдыри также могут появляться на ногах, руках и в области подгузников. Эти волдыри могут быть болезненными, а дети с HFMD часто бывают уставшими, раздражительными и отказываются от еды. 1,2,4,6

    HFMD обычно поражает маленьких детей, а вспышки могут возникать в детских садах и школах. 1

    Как мне узнать, есть ли у моего ребенка HFMD?

    Если у вашего ребенка появляются волдыри, важно показать его терапевту.

    Ваш терапевт поставит диагноз HFMD на основании симптомов, имеющихся у вашего ребенка. Обычно вашему ребенку не требуются какие-либо анализы, но в очень редких случаях могут быть взяты мазки, если диагноз не ясен. 2

    Какое лечение нужно моему ребенку от HFMD?

    HFMD не требует специального лечения, так как он поправится сам по себе.Однако лечение боли и лихорадки может помочь уменьшить дискомфорт вашего ребенка и помочь ему сохранить потребление пищи и жидкости. 1,2,5 Если у вашего ребенка жар или вы думаете, что он испытывает боль, вы можете дать парацетамол в дозировке, соответствующей его возрасту и весу. Вы можете узнать больше о том, как давать ребенку парацетамол, в нашем предыдущем блоге.

    Если у вашего ребенка волдыри во рту, боль может сказаться на его еде и питье. 2 Существуют обезболивающие (местные анестетики) жидкости / гели, которые могут помочь обезболить волдыри во рту, однако мы рекомендуем вам обсудить их с вашим терапевтом, если вы считаете, что они нужны вашему ребенку.

    Может ли мой ребенок передать HFMD другим детям или мне?

    HFMD легко распространяется при контакте с жидкостью из волдырей, слюны, слизистой оболочки носа или с фекалиями. Поэтому хорошая личная гигиена важна для предотвращения распространения вируса среди других. 1,2,5 Сюда входят:

    • Мытье рук или использование геля для рук на спиртовой основе

    • Не позволяйте ребенку делиться игрушками, столовыми приборами, полотенцами или зубными щетками

    • Тщательно вымойте все игрушки, одежду или поверхности, с которыми они контактируют

    • Научите ребенка мыть руки, прикрывать рот и нос при чихании или кашле и выбрасывать использованные салфетки 2

    HFMD обычно встречается у детей в возрасте до 10 лет, но может возникать и у взрослых.Однако большинство взрослых уже обладают иммунитетом к вирусам, вызывающим HFMD, поскольку они столкнулись с ними в детстве. 2

    Волдыри заразны, пока не покроются коркой и не высохнут. Обычно это занимает 7-10 дней после начала болезни. Вирус также может выделяться со слюной и фекалиями в течение нескольких недель после исчезновения волдырей. 1,2,4

    Как долго моему ребенку нужно не ходить в школу или детский сад?

    Если ваш ребенок ходит в школу или детский сад, важно, чтобы вы оставили его дома, чтобы избежать передачи вируса другим детям.Департамент здравоохранения Западной Австралии рекомендует исключать ребенка с HFMD из школы или детского сада до тех пор, пока на волдырях не образуются корки, которые полностью высохнут. 3

    Взрослые не обязаны отказываться от работы, если они находятся в контакте с ребенком с HFMD. 3

    Может ли мой ребенок снова заболеть HFMD?

    Инфекция вирусом, вызывающим HFMD, вызывает иммунитет к этому специфическому вирусу. Поскольку существует несколько вирусов, вызывающих HFMD, второй эпизод может произойти, если ваш ребенок столкнется с другим вирусом из группы вирусов Коксаки или энтеровирусов.Однако у большинства детей повторного заражения не будет. 1

    Может ли HFMD вызвать более серьезное заболевание?

    В то время как HFMD обычно вызывает легкое заболевание, которое проходит само по себе, 2,6 оно может реже вызывать более серьезные осложнения. К ним относятся:

    • Обезвоживание из-за недостатка жидкости. Вы можете прочитать наш предыдущий блог на Gastro, чтобы узнать больше о том, как определить, есть ли у вашего ребенка обезвоживание, и какое лечение ему может потребоваться.

    • Заражение волдырей. Если волдыри вашего ребенка имеют покраснение и жар вокруг них или выделения / корки желтого цвета, вам следует обратиться к терапевту. 7

    Очень редко вирус может поражать слизистую оболочку головного и спинного мозга, вызывая серьезные симптомы, такие как судороги, спутанность сознания, неустойчивость и слабость. 2

    Список литературы

    1. Австралийский семейный врач, 2003 г.Болезни рук, ящура
    2. Better Health Channel, 2014. Заболевания рук, ящура
    3. Министерство здравоохранения правительства Западной Австралии, 2015 г. Рекомендации по инфекционным заболеваниям: для учителей, работников детских учреждений, органов местного самоуправления и практикующих врачей
    4. Health Direct, 2016. Заболевания рук, ящура
    5. Healthy WA, 2013. Болезнь кисти, ящура
    6. Департамент здравоохранения правительства Нового Южного Уэльса, 2016 г.Информационный бюллетень по инфекционным заболеваниям: болезни рук, ящура и рта
    7. Королевская детская больница Мельбурна, 2018. Информация о здоровье детей: стафилококковые инфекции

    Эта информация носит общий характер и не может относиться к вам или другому лицу. Если у вас есть какие-либо опасения по поводу своего здоровья или здоровья и благополучия ребенка, обратитесь к врачу или другому специалисту в области здравоохранения.